Stem-loop sequence hsa-mir-148a

Accession

MI0000253

Previous IDs

hsa-mir-148

Symbol

HGNC:MIR148A

Description

Homo sapiens miR-148a stem-loop

Gene family

MIPF0000056; mir-148

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

              -  -a    cc    -   ag 
gaggcaaaguucug ag  cacu  gacu cug  u
|||||||||||||| ||  ||||  |||| |||  a
cucuguuucaagac uc  guga  cuga gau  u
              a  ac    --    a   ag 

Deep sequencing

19422 reads, 39 experiments

Genome context

• Coordinates (GRCh37.p5): chr7: 25989539-25989606 [-]
• Overlapping transcripts:

  intergenic

Database links

• ENTREZGENE: 406940;MIR148A
• HGNC: 31535;MIR148A

Mature sequence hsa-miR-148a-5p

• Accession: MIMAT0004549
• Previous IDs: hsa-miR-148a*
• Sequence: 6 - aaaguucugagacacuccgacu - 27
• Deep sequencing: 119 reads, 21 experiments
• Evidence: experimental; cloned [3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-148a-5p
  • MICRORNA.ORG:hsa-miR-148a-5p
  • MIRDB:hsa-miR-148a-5p
  • RNA22-HSA:hsa-miR-148a-5p
  • TARGETMINER:hsa-miR-148a-5p
  • PICTAR-VERT:hsa-miR-148a

Mature sequence hsa-miR-148a-3p

• Accession: MIMAT0000243
• Previous IDs: hsa-miR-148a
• Sequence: 44 - ucagugcacuacagaacuuugu - 65
• Deep sequencing: 19303 reads, 32 experiments
• Evidence: experimental; cloned [1-3], Northern [2]
• Validated targets:
  • TARBASE:hsa-miR-148a-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-148a-3p
  • MICRORNA.ORG:hsa-miR-148a-3p
  • MIRDB:hsa-miR-148a-3p
  • RNA22-HSA:hsa-miR-148a-3p
  • TARGETMINER:hsa-miR-148a-3p
  • TARGETSCAN-VERT:hsa-miR-148a
  • PICTAR-VERT:hsa-miR-148a

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).