Stem-loop sequence hsa-mir-148a

AccessionMI0000253 (change log)
Previous IDshsa-mir-148
Symbol HGNC:MIR148A
DescriptionHomo sapiens miR-148a stem-loop
Gene family MIPF0000056; mir-148
Literature search

286 open access papers mention hsa-mir-148a
(1789 sentences)

Stem-loop
                 -  -a    cc    -   ag 
5' gaggcaaaguucug ag  cacu  gacu cug  u
   |||||||||||||| ||  ||||  |||| |||  a
3' cucuguuucaagac uc  guga  cuga gau  u
                 a  ac    --    a   ag 
Get sequence
Deep sequencing
7785735 reads, 1.51e+04 reads per million, 157 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 25949919-25949986 [-]
intergenic
Database links

Mature sequence hsa-miR-148a-5p

Accession MIMAT0004549
Previous IDshsa-miR-148a*
Sequence

6 - 

aaaguucugagacacuccgacu

 - 27

Get sequence
Deep sequencing65221 reads, 141 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-148a-3p

Accession MIMAT0000243
Previous IDshsa-miR-148a
Sequence

44 - 

ucagugcacuacagaacuuugu

 - 65

Get sequence
Deep sequencing7720471 reads, 157 experiments
Evidence experimental; cloned [1-3], Northern [2]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).