Stem-loop sequence hsa-mir-148a

Accession MI0000253
Previous IDs hsa-mir-148
Symbol HGNC:MIR148A
Description Homo sapiens miR-148a stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
              -  -a    cc    -   ag 
gaggcaaaguucug ag  cacu  gacu cug  u
|||||||||||||| ||  ||||  |||| |||  a
cucuguuucaagac uc  guga  cuga gau  u
              a  ac    --    a   ag 
Get sequence
Deep sequencing
19422 reads, 39 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 25989539-25989606 [-]
intergenic
Database links

Mature sequence hsa-miR-148a-5p

Accession MIMAT0004549
Previous IDs hsa-miR-148a*
Sequence

6 - 

aaaguucugagacacuccgacu

 - 27

Get sequence
Deep sequencing 119 reads, 21 experiments
Evidence experimental; cloned [3]
Predicted targets

Mature sequence hsa-miR-148a-3p

Accession MIMAT0000243
Previous IDs hsa-miR-148a
Sequence

44 - 

ucagugcacuacagaacuuugu

 - 65

Get sequence
Deep sequencing 19303 reads, 32 experiments
Evidence experimental; cloned [1-3], Northern [2]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).