Stem-loop sequence hsa-mir-129-1

AccessionMI0000252 (change log)
Previous IDshsa-mir-129;hsa-mir-129a
Symbol HGNC:MIR129-1
DescriptionHomo sapiens miR-129-1 stem-loop
Gene family MIPF0000073; mir-129
Literature search

120 open access papers mention hsa-mir-129-1
(1000 sentences)

Stem-loop
       -       c   cu      g   uu cu  c 
5' ggau cuuuuug ggu  gggcuu cug  c  cu a
   |||| ||||||| |||  |||||| |||  |  ||  
3' ucua gaaaaac cca  cccgaa gac  g  ga a
       u       c   uu      g   -u au  c 
Get sequence
Deep sequencing
81998 reads, 69.9 reads per million, 153 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum [1]. Expression of this miRNA was subsequently verified in a human osteoblast sarcoma cell line [2]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both human (this entry and MI0000473) and mouse (MI0000222 and MI0000585). Landgraf et al. show that the 5' product of mir-129-1 (this entry) is the predominant one, whereas both 5' and 3' products are significantly expressed from mir-129-2 (MI0000585) [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 128207872-128207943 [+]
sense
OTTHUMT00000350446 ; RP11-274B21.1-001; intron 1
OTTHUMT00000468355 ; RP11-274B21.1-002; intron 2
ENST00000479267 ; RP11-274B21.1-001; intron 1
ENST00000605862 ; RP11-274B21.1-002; intron 2
Database links

Mature sequence hsa-miR-129-5p

Accession MIMAT0000242
Previous IDshsa-miR-129
Sequence

5 - 

cuuuuugcggucugggcuugc

 - 25

Get sequence
Deep sequencing127090 reads, 146 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-129-1-3p

Accession MIMAT0004548
Previous IDshsa-miR-129*
Sequence

49 - 

aagcccuuaccccaaaaaguau

 - 70

Get sequence
Deep sequencing18435 reads, 125 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).