Stem-loop sequence hsa-mir-208a

AccessionMI0000251 (change log)
Previous IDshsa-mir-208
Symbol HGNC:MIR208A
DescriptionHomo sapiens miR-208a stem-loop
Gene family MIPF0000178; mir-208
Literature search

114 open access papers mention hsa-mir-208a
(534 sentences)

Stem-loop
   u   g           g  c  gg      c  a 
5'  gac ggcgagcuuuu gc cg  uuauac ug u
    ||| ||||||||||| || ||  |||||| || g
3'  cug uuguucgaaaa cg gc  aauaug ac c
   a   g           a  a  ag      c  u 
Get sequence
Deep sequencing
11207 reads, 90 reads per million, 30 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 23388596-23388666 [-]
antisense
OTTHUMT00000313828 ; AL132780.10-001; exon 1
ENST00000424245 ; PRMT5-AS1-001; exon 1
Database links

Mature sequence hsa-miR-208a-5p

Accession MIMAT0026474
Sequence

9 - 

gagcuuuuggcccggguuauac

 - 30

Get sequence
Deep sequencing567 reads, 16 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-208a-3p

Accession MIMAT0000241
Previous IDshsa-miR-208
Sequence

44 - 

auaagacgagcaaaaagcuugu

 - 65

Get sequence
Deep sequencing10637 reads, 29 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).