Stem-loop sequence hsa-mir-208a

Accession MI0000251
Previous IDs hsa-mir-208
Symbol HGNC:MIR208A
Description Homo sapiens miR-208a stem-loop
Gene family MIPF0000178; mir-208
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-208. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-208 is a family of microRNA precursors found in animals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. In humans, the gene for miR-208 is located in an intron of MYH7.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u   g           g  c  gg      c  a 
 gac ggcgagcuuuu gc cg  uuauac ug u
 ||| ||||||||||| || ||  |||||| || g
 cug uuguucgaaaa cg gc  aauaug ac c
a   g           a  a  ag      c  u 
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 23857805-23857875 [-]
sense
OTTHUMT00000071796 ; MYH6-001; intron 28
OTTHUMT00000071796 ; MYH6-001; intron 28
OTTHUMT00000071796 ; MYH6-001; intron 28
ENST00000362287 ; MIR208A-201; exon 1
ENST00000362287 ; MIR208A-201; exon 1
ENST00000362287 ; MIR208A-201; exon 1
ENST00000356287 ; MYH6-001; intron 28
ENST00000356287 ; MYH6-001; intron 28
ENST00000356287 ; MYH6-001; intron 28
ENST00000405093 ; MYH6-201; intron 29
ENST00000405093 ; MYH6-201; intron 29
ENST00000405093 ; MYH6-201; intron 29
Database links

Mature sequence hsa-miR-208a

Accession MIMAT0000241
Previous IDs hsa-miR-208
Sequence

44 - 

auaagacgagcaaaaagcuugu

 - 65

Get sequence
Evidence by similarity; MI0000555
Validated targets
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).