Stem-loop sequence mmu-mir-207

AccessionMI0000250 (change log)
Symbol MGI:Mir207
DescriptionMus musculus miR-207 stem-loop
Gene family MIPF0000241; mir-207
Stem-loop
       c     u      cu  -         -     g ag 
5' aagg agggg gagggg  gc gggaggagc cgggc g  g
   |||| ||||| ||||||  || ||||||||| ||||| |   
3' uuuc ucucc cuccuc  cg uccucuucg guucg c  c
       -     -      -u  g         c     g gu 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 19 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 40722917-40722995 [+]
sense
OTTMUST00000015000 ; Dnaja1-001; intron 1
OTTMUST00000015001 ; Dnaja1-002; exon 1
OTTMUST00000015002 ; Dnaja1-003; intron 1
OTTMUST00000015003 ; Dnaja1-004; 3'UTR (exon 1)
OTTMUST00000015006 ; Dnaja1-007; intron 1
OTTMUST00000015008 ; Dnaja1-009; 3'UTR (exon 1)
ENSMUST00000139406 ; Dnaja1-003; intron 1
ENSMUST00000030118 ; Dnaja1-001; intron 1
ENSMUST00000137476 ; Dnaja1-007; intron 1
ENSMUST00000129204 ; Dnaja1-002; exon 1
ENSMUST00000137246 ; Dnaja1-004; 3'UTR (exon 1)
ENSMUST00000125442 ; Dnaja1-009; 3'UTR (exon 1)
ENSMUST00000164233 ; Dnaja1-201; 3'UTR (exon 1)
Database links

Mature sequence mmu-miR-207

Accession MIMAT0000240
Sequence

52 - 

gcuucuccuggcucuccucccuc

 - 74

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; cloned [1-2], Illumina [3]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).