Stem-loop sequence mmu-mir-206

AccessionMI0000249 (change log)
Symbol MGI:Mir206
DescriptionMus musculus miR-206 stem-loop
Gene family MIPF0000038; mir-1
Literature search

193 open access papers mention mmu-mir-206
(2321 sentences)

Stem-loop
        -                  c u     auau 
5' ccagg ccacaugcuucuuuauau c cauag    c
   ||||| |||||||||||||||||| | |||||    u
3' gguuu ggugugugaaggaaugua g guauc    c
        u                  a -     acga 
Get sequence
Deep sequencing
675307 reads, 2.15e+03 reads per million, 90 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 20679010-20679082 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-206
mmu-mir-206chr1: 20679010-20679082 [+]
mmu-mir-133bchr1: 20682769-20682887 [+]
Database links

Mature sequence mmu-miR-206-5p

Accession MIMAT0017004
Previous IDsmmu-miR-206*
Sequence

8 - 

acaugcuucuuuauauccucaua

 - 30

Get sequence
Deep sequencing20 reads, 9 experiments
Evidence experimental; Illumina [4]
Predicted targets

Mature sequence mmu-miR-206-3p

Accession MIMAT0000239
Previous IDsmmu-miR-206
Sequence

46 - 

uggaauguaaggaagugugugg

 - 67

Get sequence
Deep sequencing675287 reads, 89 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).