Stem-loop sequence mmu-mir-206

AccessionMI0000249
Symbol MGI:Mir206
DescriptionMus musculus miR-206 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        -                  c u     auau 
5' ccagg ccacaugcuucuuuauau c cauag    c
   ||||| |||||||||||||||||| | |||||    u
3' gguuu ggugugugaaggaaugua g guauc    c
        u                  a -     acga 
Get sequence
Deep sequencing
800890 reads, 4.86e+03 reads per million, 84 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr1: 20679010-20679082 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-206
mmu-mir-206chr1: 20679010-20679082 [+]
mmu-mir-133bchr1: 20682769-20682887 [+]
Database links

Mature sequence mmu-miR-206-5p

Accession MIMAT0017004
Previous IDsmmu-miR-206*
Sequence

8 - 

acaugcuucuuuauauccucaua

 - 30

Get sequence
Deep sequencing8 reads, 4 experiments
Evidence experimental; Illumina [4]
Predicted targets

Mature sequence mmu-miR-206-3p

Accession MIMAT0000239
Previous IDsmmu-miR-206
Sequence

46 - 

uggaauguaaggaagugugugg

 - 67

Get sequence
Deep sequencing566764 reads, 75 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Validated targets
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).