Stem-loop sequence mmu-mir-205

AccessionMI0000248 (change log)
Symbol MGI:Mir205
DescriptionMus musculus miR-205 stem-loop
Gene family MIPF0000058; mir-205
Literature search

105 open access papers mention mmu-mir-205
(840 sentences)

Stem-loop
         uc           c        ucuua 
5' cucuug  cuucauuccac ggagucug     u
   ||||||  ||||||||||| ||||||||      
3' gaggac  gaagugaggug cuuuagac     g
         uc           a        caacc 
Get sequence
Deep sequencing
109115 reads, 516 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 193507463-193507530 [-]
sense
OTTMUST00000112665 ; RP23-392F1.1-001; exon 2
ENSMUST00000180420 ; 4631405K08Rik-001; exon 2
Database links

Mature sequence mmu-miR-205-5p

Accession MIMAT0000238
Previous IDsmmu-miR-205
Sequence

7 - 

uccuucauuccaccggagucug

 - 28

Get sequence
Deep sequencing108502 reads, 68 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-205-3p

Accession MIMAT0017003
Previous IDsmmu-miR-205*
Sequence

43 - 

gauuucaguggagugaagcuca

 - 64

Get sequence
Deep sequencing613 reads, 28 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).