Stem-loop sequence mmu-mir-205

AccessionMI0000248 (change log)
Symbol MGI:Mir205
DescriptionMus musculus miR-205 stem-loop
Gene family MIPF0000058; mir-205
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-205. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-205 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. They are involved in numerous cellular processes, including development, proliferation, and apoptosis. Currently, it is believed that miRNAs elicit their effect by silencing the expression of target genes. The miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) and miR-205 are frequently silenced in advanced cancer. Studies has shown that -- by targeting the transcriptional repressors of E-cadherin, ZEB1 and ZEB2-- Mir-205 is involved in epithelial to mesenchymal transition (EMT) and tumor invasion[citation needed]. Recently, miR-200 silencing was also reported in cancer stem cells, implying that miR-200 deregulation is a key event in multiple levels of tumor biology. The cause of miR-200 silencing in naturally-occurring cancer cells, however, remains largely unknown.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         uc           c        ucuua 
5' cucuug  cuucauuccac ggagucug     u
   ||||||  ||||||||||| ||||||||      
3' gaggac  gaagugaggug cuuuagac     g
         uc           a        caacc 
Get sequence
Deep sequencing
40620 reads, 619 reads per million, 42 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 193507463-193507530 [-]
sense
OTTMUST00000112665 ; RP23-392F1.1-001; exon 2
ENSMUST00000180420 ; 4631405K08Rik-001; exon 2
Database links

Mature sequence mmu-miR-205-5p

Accession MIMAT0000238
Previous IDsmmu-miR-205
Sequence

7 - 

uccuucauuccaccggagucug

 - 28

Get sequence
Deep sequencing40068 reads, 42 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-205-3p

Accession MIMAT0017003
Previous IDsmmu-miR-205*
Sequence

43 - 

gauuucaguggagugaagcuca

 - 64

Get sequence
Deep sequencing552 reads, 17 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).