Stem-loop sequence mmu-mir-203

Accession MI0000246
Symbol MGI:Mir203
Description Mus musculus miR-203 stem-loop
Gene family MIPF0000108; mir-203
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-203. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-203 is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, such as translational repression and Argonaute-catalyzed messenger RNA cleavage. miR-203 has been identified as a skin-specific microRNA, and it forms an expression gradient that defines the boundary between proliferative epidermal basal progenitors and terminally differentiating suprabasal cells. It has also been found upregulated in psoriasis and differentially expressed in some types of cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u    c         u    g    a     c    
gcc gguc agugguucu gaca uuca caguu ugu 
||| |||| ||||||||| |||| |||| ||||| || a
cgg ccag ucaccagga uugu aagu guuaa acg 
   c    a         u    a    -     c    
Get sequence
Deep sequencing
210037 reads, 91 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr12: 112130880-112130955 [+]
intergenic
Database links

Mature sequence mmu-miR-203-5p

Accession MIMAT0004547
Previous IDs mmu-miR-203*
Sequence

10 - 

agugguucuugacaguucaaca

 - 31

Get sequence
Deep sequencing 3080 reads, 43 experiments
Evidence experimental; cloned [2], Solexa [3-4]
Predicted targets

Mature sequence mmu-miR-203-3p

Accession MIMAT0000236
Previous IDs mmu-miR-203
Sequence

48 - 

gugaaauguuuaggaccacuag

 - 69

Get sequence
Deep sequencing 206722 reads, 81 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Validated targets
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).