Stem-loop sequence mmu-mir-203

AccessionMI0000246 (change log)
Symbol MGI:Mir203
DescriptionMus musculus miR-203 stem-loop
Gene family MIPF0000108; mir-203
Literature search

103 open access papers mention mmu-mir-203
(754 sentences)

Stem-loop
      u    c         u    g    a     c    
5' gcc gguc agugguucu gaca uuca caguu ugu 
   ||| |||| ||||||||| |||| |||| ||||| || a
3' cgg ccag ucaccagga uugu aagu guuaa acg 
      c    a         u    a    -     c    
Get sequence
Deep sequencing
244163 reads, 727 reads per million, 101 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 112130880-112130955 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-203
mmu-mir-203chr12: 112130880-112130955 [+]
mmu-mir-203bchr12: 112130887-112130946 [-]
Database links

Mature sequence mmu-miR-203-5p

Accession MIMAT0004547
Previous IDsmmu-miR-203*
Sequence

10 - 

agugguucuugacaguucaaca

 - 31

Get sequence
Deep sequencing1688 reads, 54 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-203-3p

Accession MIMAT0000236
Previous IDsmmu-miR-203
Sequence

48 - 

gugaaauguuuaggaccacuag

 - 69

Get sequence
Deep sequencing242470 reads, 101 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).