Stem-loop sequence mmu-mir-201

AccessionMI0000244 (change log)
Symbol MGI:Mir201
DescriptionMus musculus miR-201 stem-loop
Gene family MIPF0000386; mir-743
Stem-loop
           u   u            uuc   a 
5' uaccuuac cag aaggcauuguuc   uau u
   |||||||| ||| ||||||||||||   |||  
3' augggaug guc uuccgugacaag   aua u
           u   u            uaa   a 
Get sequence
Deep sequencing
1197 reads, 220 reads per million, 25 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 67988096-67988161 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-201
mmu-mir-547chrX: 67988374-67988451 [-]
mmu-mir-201chrX: 67988096-67988161 [-]
Database links

Mature sequence mmu-miR-201-5p

Accession MIMAT0000234
Previous IDsmmu-miR-201
Sequence

6 - 

uacucaguaaggcauuguucuu

 - 27

Get sequence
Deep sequencing1154 reads, 25 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-201-3p

Accession MIMAT0017001
Previous IDsmmu-miR-201*
Sequence

41 - 

ugaacagugccuuucuguguagg

 - 63

Get sequence
Deep sequencing43 reads, 10 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).