Stem-loop sequence mmu-mir-200b

AccessionMI0000243 (change log)
Symbol MGI:Mir200b
DescriptionMus musculus miR-200b stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
        ggc    -    ug     c      u gug 
5' gccgu   cauc uuac  ggcag auugga a   u
   |||||   |||| ||||  ||||| |||||| |    
3' cggca   guag aaug  ccguc uaaucu u   c
        ---    u    gu     a      c agu 
Get sequence
Deep sequencing
113585 reads, 967 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 156055681-156055750 [-]
sense
OTTMUST00000117417 ; Ttll10-005; intron 1
OTTMUST00000025771 ; Ttll10-001; intron 1
OTTMUST00000031955 ; RP23-118E21.8-001; intron 1
ENSMUST00000184348 ; Ttll10-005; intron 1
ENSMUST00000097731 ; Ttll10-001; intron 1
ENSMUST00000138361 ; Gm13648-001; intron 1
ENSMUST00000083615 ; Mir200b-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-200b
mmu-mir-200bchr4: 156055681-156055750 [-]
mmu-mir-200achr4: 156054896-156054985 [-]
mmu-mir-429chr4: 156053905-156053987 [-]
Database links

Mature sequence mmu-miR-200b-5p

Accession MIMAT0004545
Previous IDsmmu-miR-200b*
Sequence

9 - 

caucuuacugggcagcauugga

 - 30

Get sequence
Deep sequencing3735 reads, 69 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-200b-3p

Accession MIMAT0000233
Previous IDsmmu-miR-200b
Sequence

45 - 

uaauacugccugguaaugauga

 - 66

Get sequence
Deep sequencing109850 reads, 76 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).