Stem-loop sequence mmu-mir-200b

AccessionMI0000243 (change log)
Symbol MGI:Mir200b
DescriptionMus musculus miR-200b stem-loop
Gene family MIPF0000019; mir-8
Literature search

294 open access papers mention mmu-mir-200b
(2217 sentences)

Stem-loop
        ggc    -    ug     c      u gug 
5' gccgu   cauc uuac  ggcag auugga a   u
   |||||   |||| ||||  ||||| |||||| |    
3' cggca   guag aaug  ccguc uaaucu u   c
        ---    u    gu     a      c agu 
Get sequence
Deep sequencing
313052 reads, 845 reads per million, 102 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 156055681-156055750 [-]
sense
OTTMUST00000117417 ; Ttll10-005; intron 1
OTTMUST00000025771 ; Ttll10-001; intron 1
OTTMUST00000031955 ; RP23-118E21.8-001; intron 1
ENSMUST00000184348 ; Ttll10-005; intron 1
ENSMUST00000097731 ; Ttll10-001; intron 1
ENSMUST00000138361 ; Gm13648-001; intron 1
ENSMUST00000083615 ; Mir200b-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-200b
mmu-mir-200bchr4: 156055681-156055750 [-]
mmu-mir-200achr4: 156054896-156054985 [-]
mmu-mir-429chr4: 156053905-156053987 [-]
Database links

Mature sequence mmu-miR-200b-5p

Accession MIMAT0004545
Previous IDsmmu-miR-200b*
Sequence

9 - 

caucuuacugggcagcauugga

 - 30

Get sequence
Deep sequencing8701 reads, 85 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-200b-3p

Accession MIMAT0000233
Previous IDsmmu-miR-200b
Sequence

45 - 

uaauacugccugguaaugauga

 - 66

Get sequence
Deep sequencing304350 reads, 102 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).