Stem-loop sequence MI0000242

Accession

MI0000242

ID

hsa-mir-199a-1

Symbol

HGNC:MIR199A1

Description

Homo sapiens miR-199a-1 stem-loop

Stem-loop

   aac       u        c   u  ---g     
gcc   ccagugu cagacuac ugu ca    gagg 
|||   ||||||| |||||||| ||| ||    ||| c
cgg   gguuaca gucugaug aca gu    cucu 
   auu       c        -   u  guaa     

Comments

Lagos-Quintana et al. [1] cloned miR-199 from human osteoblast sarcoma cells. They also reported identification of a miRNA from the opposite arm in mouse cells. This sequence was named miR-199-s and the sequence from the 3' arm of the homologous mouse precursor miR-199-as. Lim et al. [2] independently predicted this miRNA computationally using conservation with mouse and Fugu rubripes sequences [2]. Expression of the miR excised from the 5' arm was validated in zebrafish, and the ends mapped by cloning. The excised miR sequences are renamed miR-199a (to avoid confusion with the subsequently identified miR-199b (MI0000282 )) and miR-199a* (from the 3' arm) here. The two putative hairpin precursors in human map to chromosome 19 (mir-199a-1, MI0000242 ) and chromosome 1 (mir-199a-2, MI0000281 ). Landgraf et al. show that both mature products are expressed, prompting the renaming to miR-199a-5p and miR-199a-3p [4].

Genome context

• Coordinates (GRCh37): 19: 10928102-10928172 [-]
• Overlapping transcripts:

  antisense

  ENST00000314646 ; DNM2-201; intron 14

  ENST00000355667 ; DNM2-202; intron 14

  ENST00000408974 ; DNM2-206; intron 15

  ENST00000389253 ; DNM2-205; intron 15

  ENST00000359692 ; DNM2-203; intron 15

  ENST00000389252 ; DNM2-204; intron 15

View flanking features

Database links

• EMBL: AJ560756;HSA560756
• HGNC: 31571;MIR199A1
• ENTREZGENE: 406976;MIR199A1

Gene family

MIPF0000040; mir-199

Mature sequence MIMAT0000231

• Accession: MIMAT0000231
• ID: hsa-miR-199a-5p
• Sequence: 6 - cccaguguucagacuaccuguuc - 28
• Evidence: experimental; cloned [1,3-4]
• Predicted targets:
  • MICROCOSM:hsa-miR-199a-5p
  • MICRORNA.ORG:hsa-miR-199a-5p
  • TARGETSCAN:hsa-miR-199a-5p
  • PICTAR-VERT:hsa-miR-199a
  • PICTAR-VERT:hsa-miR-199a*

Mature sequence MIMAT0000232

• Accession: MIMAT0000232
• ID: hsa-miR-199a-3p
• Sequence: 47 - acaguagucugcacauugguua - 68
• Evidence: experimental; cloned [4], Solexa [5]
• Predicted targets:
  • MICROCOSM:hsa-miR-199a-3p
  • MICRORNA.ORG:hsa-miR-199a-3p
  • TARGETSCAN:hsa-miR-199a-3p

References

1. "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2. "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3. "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4. "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).