Stem-loop sequence hsa-mir-199a-1

Accession MI0000242
Previous IDs hsa-mir-199-s
Symbol HGNC:MIR199A1
Description Homo sapiens miR-199a-1 stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. (MIPF0000040). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   aac       u        c   u  ---g     
gcc   ccagugu cagacuac ugu ca    gagg 
|||   ||||||| |||||||| ||| ||    ||| c
cgg   gguuaca gucugaug aca gu    cucu 
   auu       c        -   u  guaa     
Get sequence
Deep sequencing
164054 reads, 69 experiments
Comments

Lagos-Quintana et al. [1] cloned miR-199 from human osteoblast sarcoma cells. They also reported identification of a miRNA from the opposite arm in mouse cells. This sequence was named miR-199-s and the sequence from the 3' arm of the homologous mouse precursor miR-199-as. Lim et al. [2] independently predicted this miRNA computationally using conservation with mouse and Fugu rubripes sequences [2]. Expression of the miR excised from the 5' arm was validated in zebrafish, and the ends mapped by cloning. The excised miR sequences are renamed miR-199a (to avoid confusion with the subsequently identified miR-199b (MI0000282 )) and miR-199a* (from the 3' arm) here. The two putative hairpin precursors in human map to chromosome 19 (mir-199a-1, MI0000242 ) and chromosome 1 (mir-199a-2, MI0000281 ). Landgraf et al. show that both mature products are expressed, prompting the renaming to miR-199a-5p and miR-199a-3p [4].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 10928102-10928172 [-]
antisense
ENST00000545324 ; DNM2-207; intron 1
ENST00000545324 ; DNM2-207; intron 1
ENST00000408974 ; DNM2-206; intron 14
ENST00000355667 ; DNM2-202; intron 14
ENST00000408974 ; DNM2-206; intron 14
ENST00000355667 ; DNM2-202; intron 14
ENST00000408974 ; DNM2-205; intron 14
ENST00000355667 ; DNM2-202; intron 14
ENST00000389252 ; DNM2-204; intron 15
ENST00000359692 ; DNM2-203; intron 15
ENST00000389253 ; DNM2-205; intron 15
ENST00000314646 ; DNM2-201; intron 15
ENST00000389252 ; DNM2-204; intron 15
ENST00000359692 ; DNM2-203; intron 15
ENST00000389253 ; DNM2-205; intron 15
ENST00000314646 ; DNM2-201; intron 15
ENST00000359692 ; DNM2-203; intron 15
ENST00000389253 ; DNM2-204; intron 15
ENST00000314646 ; DNM2-201; intron 15
Database links

Mature sequence hsa-miR-199a-5p

Accession MIMAT0000231
Previous IDs hsa-miR-199a
Sequence

6 - 

cccaguguucagacuaccuguuc

 - 28

Get sequence
Deep sequencing 4263 reads, 36 experiments
Evidence experimental; cloned [1,3-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-199a-3p

Accession MIMAT0000232
Previous IDs hsa-miR-199a*
Sequence

47 - 

acaguagucugcacauugguua

 - 68

Get sequence
Deep sequencing 159789 reads, 54 experiments
Evidence experimental; cloned [4], Solexa [5]
Validated targets
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5