miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0000241

Accession MI0000241
ID mmu-mir-199a-1
Symbol MGI:Mir199a-1
Description Mus musculus miR-199a-1 stem-loop
Stem-loop 
   auc       u        c   -------    g 
gcc   ccagugu cagacuac ugu       ucag a
|||   ||||||| |||||||| |||       ||||  
cgg   gguuaca gucugaug aca       gguc g
   auu       c        -   uguacag    g
Get sequence
Comments

The hairpin precursor sequence mir-199 maps to two loci within 50 kb on mouse chromosome 9. This sequence was named mir-199 in [1] and [2], but is renamed here to avoid overlap with the predicted homologues of human mir-199a-2 and mir-199b. Landgraf et al. demonstrate comparable expression for products from both arms of the hairpin, which are therefore renamed miR-199a-5p and miR-199a-3p here [4]. The mature sequences shown here represent the most commonly cloned forms from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (NCBIM37) Overlapping transcripts
9: 21300939-21301008 [-]
antisense
ENSMUST00000091087 ; Dnm2-202; intron 14
ENSMUST00000072362 ; Dnm2-201; intron 15
ENSMUST00000115404 ; Dnm2-203; intron 16

View flanking features
Database links
Gene family

MIPF0000040; mir-199

Mature sequence MIMAT0000229

Accession MIMAT0000229
ID mmu-miR-199a-5p
Sequence

6 -  

cccaguguucagacuaccuguuc

 - 28

Get sequence
Evidence experimental; cloned [2,4], Northern [2]
Predicted targets

Mature sequence MIMAT0000230

Accession MIMAT0000230
ID mmu-miR-199a-3p
Sequence

46 -  

acaguagucugcacauugguua

 - 67

Get sequence
Evidence experimental; cloned [1-4], Northern [2]
Predicted targets

References

1
"New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
"Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
"Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
4
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).