Stem-loop sequence hsa-mir-198

Accession MI0000240
Symbol HGNC:MIR198
Description Homo sapiens miR-198 stem-loop
Gene family MIPF0000090; mir-198
Stem-loop 
     -gg  cag        u   uuccug 
ucauu   uc   aggggaga agg      u
|||||   ||   |||||||| |||       
aguaa   ag   ucucuucu ucc      g
     aua  aua        -   uuuuua
Get sequence
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 120114515-120114576 [-]
sense
OTTHUMT00000355399 ; FSTL1-001; 3'UTR (exon 11)
OTTHUMT00000355399 ; FSTL1-001; 3'UTR (exon 11)
OTTHUMT00000355399 ; FSTL1-001; 3'UTR (exon 11)
ENST00000295633 ; FSTL1-001; 3'UTR (exon 11)
ENST00000295633 ; FSTL1-001; 3'UTR (exon 11)
ENST00000295633 ; FSTL1-001; 3'UTR (exon 11)
Database links

Mature sequence hsa-miR-198

Accession MIMAT0000228
Sequence

6 -  

gguccagaggggagauagguuc

 - 27

Get sequence
Evidence experimental; cloned [1-2]
Validated targets
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).