Stem-loop sequence hsa-mir-197

AccessionMI0000239 (change log)
Symbol HGNC:MIR197
DescriptionHomo sapiens miR-197 stem-loop
Gene family MIPF0000123; mir-197
Literature search

71 open access papers mention hsa-mir-197
(290 sentences)

Stem-loop
           c    a       ca    ga   -   a 
5' ggcugugc gggu gagaggg  gugg  ggu aag g
   |||||||| |||| |||||||  ||||  ||| |||  
3' ccgguacg ccca cucuucc  cacu  cca uuc c
           a    c       ac    uc   c   u 
Get sequence
Deep sequencing
84625 reads, 196 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 109598893-109598967 [+]
intergenic
Database links

Mature sequence hsa-miR-197-5p

Accession MIMAT0022691
Sequence

9 - 

cggguagagagggcagugggagg

 - 31

Get sequence
Deep sequencing974 reads, 74 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-197-3p

Accession MIMAT0000227
Previous IDshsa-miR-197
Sequence

48 - 

uucaccaccuucuccacccagc

 - 69

Get sequence
Deep sequencing83633 reads, 159 experiments
Evidence experimental; cloned [1-3]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).