Stem-loop sequence hsa-mir-196a-1

AccessionMI0000238 (change log)
Previous IDshsa-mir-196;hsa-mir-196-1
Symbol HGNC:MIR196A1
DescriptionHomo sapiens miR-196a-1 stem-loop
Gene family MIPF0000031; mir-196
Literature search

215 open access papers mention hsa-mir-196a-1
(1218 sentences)

Stem-loop
         ua   a    c         - gc ugg 
5' gugaau  ggu guuu auguuguug g  c   g
   ||||||  ||| |||| ||||||||| |  |   u
3' cacuua  cca caaa uacaacaac c  g   u
         gc   c    u         a aa ucu 
Get sequence
Deep sequencing
586257 reads, 1.43e+03 reads per million, 156 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Lagos-Quintana et al. [1] cloned this miRNA from human osteoblast sarcoma cells. Lim et al [2] independently predicted this miRNA by computational methods using conservation with mouse and Fugu rubripes sequences [2]. Expression of the excised miR was validated in zebrafish. The sequence maps to human chromosome 17. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 48632490-48632559 [-]
antisense
OTTHUMT00000367655 ; SPATA20-008; intron 12
OTTHUMT00000367651 ; SPATA20-004; intron 14
OTTHUMT00000367653 ; SPATA20-006; intron 14
OTTHUMT00000367648 ; SPATA20-001; intron 15
OTTHUMT00000367650 ; SPATA20-003; intron 15
OTTHUMT00000367649 ; SPATA20-002; intron 16
ENST00000503063 ; SPATA20-008; intron 12
ENST00000356488 ; SPATA20-004; intron 14
ENST00000511937 ; SPATA20-006; intron 14
ENST00000006658 ; SPATA20-001; intron 15
ENST00000503127 ; SPATA20-003; intron 15
ENST00000393244 ; SPATA20-201; intron 15
ENST00000504334 ; SPATA20-002; intron 16
Database links

Mature sequence hsa-miR-196a-5p

Accession MIMAT0000226
Previous IDshsa-miR-196a
Sequence

7 - 

uagguaguuucauguuguuggg

 - 28

Get sequence
Deep sequencing1120852 reads, 155 experiments
Evidence experimental; cloned [3-5]
Database links
Predicted targets

Mature sequence hsa-miR-196a-1-3p

Accession MIMAT0037307
Sequence

45 - 

caacaacauuaaaccacccga

 - 65

Get sequence
Deep sequencing163 reads, 42 experiments
Evidence not experimental

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3
PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).