Stem-loop sequence hsa-mir-196a-1

Accession MI0000238
Previous IDs hsa-mir-196;hsa-mir-196-1
Symbol HGNC:MIR196A1
Description Homo sapiens miR-196a-1 stem-loop
Gene family MIPF0000031; mir-196
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-196_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-196 is a non-coding RNA called a microRNA that has been shown to be expressed in human (MI0000238, MI0000279) and mouse (MI0000552, MI0000553). miR-196 appears to be a vertebrate specific microRNA and has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000031). In many species the miRNA appears to be expressed from intergenic regions in HOX gene clusters. The hairpin precursors are predicted based on base pairing and cross-species conservation—their extents are not known. In this case the mature sequence is excised from the 5' arm of the hairpin. It has been suggested that a rare SNP (rs11614913) that overlaps hsa-mir-196a2 has been found to be associated with non-small cell lung carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      ua   a    c         - gc ugg 
gugaau  ggu guuu auguuguug g  c   g
||||||  ||| |||| ||||||||| |  |   u
cacuua  cca caaa uacaacaac c  g   u
      gc   c    u         a aa ucu 
Get sequence
Deep sequencing
2147 reads, 1.13e+03 reads per million, 60 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Lagos-Quintana et al. [1] cloned this miRNA from human osteoblast sarcoma cells. Lim et al [2] independently predicted this miRNA by computational methods using conservation with mouse and Fugu rubripes sequences [2]. Expression of the excised miR was validated in zebrafish. The sequence maps to human chromosome 17. Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 46709852-46709921 [-]
sense
OTTHUMT00000358099 ; HOXB7-004; intron 2
ENST00000567101 ; HOXB7-004; intron 2
antisense
OTTHUMT00000358090 ; RP11-357H14.4-002; intron 1
OTTHUMT00000358089 ; RP11-357H14.4-001; intron 1
ENST00000480386 ; HOXB-AS4-002; intron 1
ENST00000462131 ; HOXB-AS4-001; intron 1
Database links

Mature sequence hsa-miR-196a-5p

Accession MIMAT0000226
Previous IDs hsa-miR-196a
Sequence

7 - 

uagguaguuucauguuguuggg

 - 28

Get sequence
Deep sequencing 4541 reads, 62 experiments
Evidence experimental; cloned [12554859,17604727,17616659]
Validated targets
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3
PMID:15105502 "MicroRNA-directed cleavage of HOXB8 mRNA" Yekta S, Shih IH, Bartel DP Science. 304:594-596(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).