Stem-loop sequence mmu-mir-195a

AccessionMI0000237 (change log)
Previous IDsmmu-mir-195
Symbol MGI:Mir195a
DescriptionMus musculus miR-195 stem-loop
Gene family MIPF0000006; mir-15
Literature search

100 open access papers mention mmu-mir-195a
(411 sentences)

Stem-loop
   a    ca     -     cucu          -a          u  gga 
5'  cacc  acucu ccugg    agcagcacag  aauauuggca gg   a
    ||||  ||||| |||||    ||||||||||  |||||||||| ||   g
3'  gugg  uggga ggacc    ucgucguguc  uuauaaccgu cu   u
   a    --     c     ----          gg          -  gag 
Get sequence
Deep sequencing
163629 reads, 810 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 70235042-70235135 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-195a
mmu-mir-497bchr11: 70234692-70234816 [-]
mmu-mir-497achr11: 70234717-70234800 [+]
mmu-mir-195achr11: 70235042-70235135 [+]
Database links

Mature sequence mmu-miR-195a-5p

Accession MIMAT0000225
Previous IDsmmu-miR-195;mmu-miR-195-5p
Sequence

21 - 

uagcagcacagaaauauuggc

 - 41

Get sequence
Deep sequencing161095 reads, 107 experiments
Evidence experimental; cloned [1-3], Illumina [4,6]
Database links
Predicted targets

Mature sequence mmu-miR-195a-3p

Accession MIMAT0017000
Previous IDsmmu-miR-195*;mmu-miR-195-3p
Sequence

59 - 

ccaauauuggcugugcugcucc

 - 80

Get sequence
Deep sequencing2436 reads, 55 experiments
Evidence experimental; 454 [5], Illumina [6]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).