Stem-loop sequence mmu-mir-195a

Accession MI0000237
Previous IDs mmu-mir-195
Symbol MGI:Mir195
Description Mus musculus miR-195 stem-loop
Gene family MIPF0000006; mir-15
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-15_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-15 microRNA precursor family is made up of small non-coding RNA genes that regulate gene expression. The family includes the related mir-15a and mir-15b sequences, as well as miR-16-1, miR-16-2, miR-195 and miR-497. These six highly conserved miRNAs are clustered on three separate chromosomes. In humans miR-15a and miR-16 are clustered within 0.5 kilobases at chromosome position 13q14. This region has been found to be the most commonly affected in chronic lymphocytic leukaemia (CLL), with deletions of the entire region in more than half of cases. Both miR-15a and miR-16 are thus frequently deleted or down-regulated in CLL samples with 13q14 deletions; occurring in more than two thirds of CLL cases. miR-15a/16-1 deletion has been shown to accelerate the proliferation of both human and mouse B-cells through modulation of the expression of genes controlling cell cycle progression. Studies have found the miR-15a/16-1 microRNA cluster to function as a tumour suppressor, with the oncogene BCL2 as its target. Specifically, miR-15a/16-1 downregulates BCL2 expression and is itself deleted or downregulated in tumour cells. There is a marked increase in BCL2 levels observed in advanced prostate tumour cases, which is inversely correlated with miR-15a/16-1 expression (and so corresponds to a decrease in miR-15a/16-1 levels). Inhibition of cell proliferation by the miR-15a/16-1 cluster occurs in both lymphoid and non-lymphoid tissue. The miR-15a/16-1 cluster has further been found to be highly expressed in CD5+ cells, therefore hinting at an important role of miR-15/16 in normal CD5+ B-cell homeostasis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a    ca     -     cucu          -a          u  gga 
 cacc  acucu ccugg    agcagcacag  aauauuggca gg   a
 ||||  ||||| |||||    ||||||||||  |||||||||| ||   g
 gugg  uggga ggacc    ucgucguguc  uuauaaccgu cu   u
a    --     c     ----          gg          -  gag 
Get sequence
Deep sequencing
105274 reads, 96 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 70235042-70235135 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-195a
mmu-mir-497 chr11: 70234717-70234800 [+]
mmu-mir-195a chr11: 70235042-70235135 [+]
Database links

Mature sequence mmu-miR-195a-5p

Accession MIMAT0000225
Previous IDs mmu-miR-195;mmu-miR-195-5p
Sequence

21 - 

uagcagcacagaaauauuggc

 - 41

Get sequence
Deep sequencing 71767 reads, 81 experiments
Evidence experimental; cloned [1-3], Solexa [4,6]
Validated targets
Predicted targets

Mature sequence mmu-miR-195a-3p

Accession MIMAT0017000
Previous IDs mmu-miR-195*;mmu-miR-195-3p
Sequence

59 - 

ccaauauuggcugugcugcucc

 - 80

Get sequence
Deep sequencing 100 reads, 20 experiments
Evidence experimental; 454 [5], Solexa [6]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).