Stem-loop sequence mmu-mir-193a

AccessionMI0000235 (change log)
Previous IDsmmu-mir-193
Symbol MGI:Mir193a
DescriptionMus musculus miR-193 stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
      ag     u     cg   a  a    agu 
5' gag  cuggg cuuug  ggc ag ugag   g
   |||  ||||| |||||  ||| || ||||    
3' cuc  gaccc gaaac  ccg uc acuu   u
      cu     u     au   g  a    gac 
Get sequence
Deep sequencing
48006 reads, 334 reads per million, 71 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 79711969-79712034 [+]
intergenic
Database links

Mature sequence mmu-miR-193a-5p

Accession MIMAT0004544
Previous IDsmmu-miR-193*;mmu-miR-193-5p
Sequence

7 - 

ugggucuuugcgggcaagauga

 - 28

Get sequence
Deep sequencing6070 reads, 64 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-193a-3p

Accession MIMAT0000223
Previous IDsmmu-miR-193;mmu-miR-193-3p
Sequence

41 - 

aacuggccuacaaagucccagu

 - 62

Get sequence
Deep sequencing41936 reads, 71 experiments
Evidence experimental; cloned [1-3], Northern [2], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).