Stem-loop sequence hsa-mir-192

AccessionMI0000234
Symbol HGNC:MIR192
DescriptionHomo sapiens miR-192 stem-loop
Gene family MIPF0000063; mir-192
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-192/215_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-192 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse and human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-192 and mir-215 are thought to be positive regulators of p53, a human tumour suppressor. They are also overexpressed in gastric cancer, and could potentially be used as biomarkers or therapeutic targets. It has also been suggested that mir-192 could be used as a biomarker for drug-induced liver damage.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   gccgagacc   u  --   g g  c         -     a       ugcucuc 
5'          gag gc  aca g cu ugaccuaug aauug cagccag       g
            ||| ||  ||| | || ||||||||| ||||| |||||||        
3'          cuc cg  ugu u ga acuggauac uuaac gucgguc       u
   cgaccguaa   -  cu   a g  c         c     c       uccccuc 
Get sequence
Deep sequencing
327631 reads, 4.81e+03 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Lagos-Quintana et al. validated the presence of an 18 nt excised sequence by cloning [1]. Lim et al. predicted the miR by computational methods using conservation with mouse and Fugu rubripes sequences. Expression of the excised miR was validated in zebrafish, and the 5' end mapped by PCR [2]. The 3' ends of the reported sequences differ by 3 nt - this entry contains the longer sequence. Lim et al. report three separate copies of this gene named mir-192-1, -2 and -3 based on 2001 human genome assemblies [2]. Subsequent assemblies suggest the presence of only one gene located on chromosome 11.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr11: 64891137-64891246 [-]
sense
OTTHUMT00000385272 ; SYVN1-012; intron 1
ENST00000530451 ; SYVN1-012; intron 1
antisense
OTTHUMT00000385288 ; MRPL49-002; intron 1
OTTHUMT00000385289 ; MRPL49-007; intron 1
OTTHUMT00000385290 ; MRPL49-008; intron 1
OTTHUMT00000385291 ; MRPL49-004; intron 1
OTTHUMT00000385292 ; MRPL49-006; intron 1
OTTHUMT00000385293 ; MRPL49-001; intron 1
OTTHUMT00000385294 ; MRPL49-009; intron 1
OTTHUMT00000385295 ; MRPL49-005; intron 1
ENST00000524482 ; MRPL49-002; intron 1
ENST00000528529 ; MRPL49-007; intron 1
ENST00000534078 ; MRPL49-008; intron 1
ENST00000526319 ; MRPL49-004; intron 1
ENST00000526171 ; MRPL49-006; intron 1
ENST00000279242 ; MRPL49-001; intron 1
ENST00000531705 ; MRPL49-009; intron 1
ENST00000533943 ; MRPL49-005; intron 1
Clustered miRNAs
< 10kb from hsa-mir-192
hsa-mir-6750chr11: 64898363-64898437 [-]
hsa-mir-194-2chr11: 64891355-64891439 [-]
hsa-mir-192chr11: 64891137-64891246 [-]
Database links

Mature sequence hsa-miR-192-5p

Accession MIMAT0000222
Previous IDshsa-miR-192
Sequence

24 - 

cugaccuaugaauugacagcc

 - 44

Get sequence
Deep sequencing16241 reads, 63 experiments
Evidence experimental; cloned [3-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-192-3p

Accession MIMAT0004543
Previous IDshsa-miR-192*
Sequence

67 - 

cugccaauuccauaggucacag

 - 88

Get sequence
Deep sequencing18 reads, 11 experiments
Evidence experimental; cloned [4]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).