Stem-loop sequence hsa-mir-192

AccessionMI0000234 (change log)
Symbol HGNC:MIR192
DescriptionHomo sapiens miR-192 stem-loop
Gene family MIPF0000063; mir-192
Literature search

214 open access papers mention hsa-mir-192
(1082 sentences)

Stem-loop
   gccgagacc   u  --   g g  c         -     a       ugcucuc 
5'          gag gc  aca g cu ugaccuaug aauug cagccag       g
            ||| ||  ||| | || ||||||||| ||||| |||||||        
3'          cuc cg  ugu u ga acuggauac uuaac gucgguc       u
   cgaccguaa   -  cu   a g  c         c     c       uccccuc 
Get sequence
Deep sequencing
1045613 reads, 781 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Lagos-Quintana et al. validated the presence of an 18 nt excised sequence by cloning [1]. Lim et al. predicted the miR by computational methods using conservation with mouse and Fugu rubripes sequences. Expression of the excised miR was validated in zebrafish, and the 5' end mapped by PCR [2]. The 3' ends of the reported sequences differ by 3 nt - this entry contains the longer sequence. Lim et al. report three separate copies of this gene named mir-192-1, -2 and -3 based on 2001 human genome assemblies [2]. Subsequent assemblies suggest the presence of only one gene located on chromosome 11.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 64891137-64891246 [-]
sense
OTTHUMT00000385272 ; SYVN1-012; intron 1
ENST00000530451 ; SYVN1-012; intron 1
antisense
OTTHUMT00000385288 ; MRPL49-002; intron 1
OTTHUMT00000385289 ; MRPL49-007; intron 1
OTTHUMT00000385290 ; MRPL49-008; intron 1
OTTHUMT00000385291 ; MRPL49-004; intron 1
OTTHUMT00000385292 ; MRPL49-006; intron 1
OTTHUMT00000385293 ; MRPL49-001; intron 1
OTTHUMT00000385294 ; MRPL49-009; intron 1
OTTHUMT00000385295 ; MRPL49-005; intron 1
ENST00000524482 ; MRPL49-002; intron 1
ENST00000528529 ; MRPL49-007; intron 1
ENST00000534078 ; MRPL49-008; intron 1
ENST00000526319 ; MRPL49-004; intron 1
ENST00000526171 ; MRPL49-006; intron 1
ENST00000279242 ; MRPL49-001; intron 1
ENST00000531705 ; MRPL49-009; intron 1
ENST00000533943 ; MRPL49-005; intron 1
Clustered miRNAs
< 10kb from hsa-mir-192
hsa-mir-6750chr11: 64898363-64898437 [-]
hsa-mir-194-2chr11: 64891355-64891439 [-]
hsa-mir-192chr11: 64891137-64891246 [-]
Database links

Mature sequence hsa-miR-192-5p

Accession MIMAT0000222
Previous IDshsa-miR-192
Sequence

24 - 

cugaccuaugaauugacagcc

 - 44

Get sequence
Deep sequencing1045071 reads, 159 experiments
Evidence experimental; cloned [3-4]
Database links
Predicted targets

Mature sequence hsa-miR-192-3p

Accession MIMAT0004543
Previous IDshsa-miR-192*
Sequence

67 - 

cugccaauuccauaggucacag

 - 88

Get sequence
Deep sequencing452 reads, 93 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).