Stem-loop sequence mmu-mir-191

AccessionMI0000233 (change log)
Symbol MGI:Mir191
DescriptionMus musculus miR-191 stem-loop
Gene family MIPF0000194; mir-191
Literature search

61 open access papers mention mmu-mir-191
(160 sentences)

Stem-loop
         c          c  aa       uu  -  c 
5' agcggg aacggaaucc aa  gcagcug  gu cu c
   |||||| |||||||||| ||  |||||||  || ||  
3' ucgucc uugcuuuagg uu  cgucgac  ua ga a
         c          -  ca       cu  c  g 
Get sequence
Deep sequencing
4507311 reads, 1.27e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 108568319-108568392 [+]
antisense
ENSMUST00000175174 ; Gm24083-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-191
mmu-mir-191chr9: 108568319-108568392 [+]
mmu-mir-425chr9: 108568777-108568861 [+]
Database links

Mature sequence mmu-miR-191-5p

Accession MIMAT0000221
Previous IDsmmu-miR-191
Sequence

7 - 

caacggaaucccaaaagcagcug

 - 29

Get sequence
Deep sequencing4502528 reads, 107 experiments
Evidence experimental; cloned [1-4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-191-3p

Accession MIMAT0004542
Previous IDsmmu-miR-191*
Sequence

49 - 

gcugcacuuggauuucguuccc

 - 70

Get sequence
Deep sequencing4748 reads, 98 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).