Stem-loop sequence mmu-mir-190a

AccessionMI0000232 (change log)
Previous IDsmmu-mir-190
Symbol MGI:Mir190a
DescriptionMus musculus miR-190 stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
       - ug               ua     uuau 
5' cugu g  auauguuugauauau  gguug    u
   |||| |  |||||||||||||||  |||||     
3' gaca c  uauacgaacuauaua  ucaac    u
       u cu               --     cuaa 
Get sequence
Deep sequencing
7542 reads, 75 reads per million, 52 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 67236660-67236726 [-]
sense
ENSMUST00000102424 ; Mir190-201; exon 1
ENSMUST00000040025 ; Tln2-202; intron 53
ENSMUST00000039662 ; Tln2-201; intron 53
Database links

Mature sequence mmu-miR-190a-5p

Accession MIMAT0000220
Previous IDsmmu-miR-190;mmu-miR-190-5p
Sequence

6 - 

ugauauguuugauauauuaggu

 - 27

Get sequence
Deep sequencing7451 reads, 51 experiments
Evidence experimental; cloned [1-2], Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-190a-3p

Accession MIMAT0016998
Previous IDsmmu-miR-190*;mmu-miR-190-3p
Sequence

42 - 

acuauauaucaagcauauuccu

 - 63

Get sequence
Deep sequencing91 reads, 18 experiments
Evidence experimental; 454 [3], Illumina [4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).