Stem-loop sequence mmu-mir-24-1

AccessionMI0000231 (change log)
Previous IDsmmu-mir-189
Symbol MGI:Mir24-1
DescriptionMus musculus miR-24-1 stem-loop
Gene family MIPF0000041; mir-24
Literature search

141 open access papers mention mmu-mir-24-1
(1276 sentences)

Stem-loop 
       g  g   a         ua     ucuca 
5' cucc gu ccu cugagcuga  ucagu     u
   |||| || ||| |||||||||  |||||     u
3' gagg ca gga gacuugacu  gguca     u
       a  a   c         -c     cacac
Get sequence
Deep sequencing
2352080 reads, 1.11e+04 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr13: 63301208-63301275 [+]
sense
OTTMUST00000076332 ; AC130827.2-002; intron 3
ENSMUST00000159152 ; 2010111I01Rik-002; intron 3
ENSMUST00000021911 ; 2010111I01Rik-201; intron 15
antisense
ENSMUST00000175000 ; Mir3074-1-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-24-1
mmu-mir-23bchr13: 63300484-63300557 [+]
mmu-mir-27bchr13: 63300712-63300784 [+]
mmu-mir-3074-1chr13: 63301199-63301283 [-]
mmu-mir-24-1chr13: 63301208-63301275 [+]
Database links

Mature sequence mmu-miR-24-1-5p

Accession MIMAT0000218
Previous IDsmmu-miR-189;mmu-miR-24*;mmu-miR-24-1*
Sequence

6 -  

gugccuacugagcugauaucagu

 - 28

Get sequence
Deep sequencing24109 reads, 103 experiments
Evidence experimental; cloned [2,7], Illumina [8-9]
Database links
Predicted targets

Mature sequence mmu-miR-24-3p

Accession MIMAT0000219
Previous IDsmmu-miR-24
Sequence

44 -  

uggcucaguucagcaggaacag

 - 65

Get sequence
Deep sequencing4657101 reads, 107 experiments
Evidence experimental; cloned [1-2,4-6], Northern [2], Illumina [7]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
4
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
5
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
6
PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
7
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
8
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
9
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).