![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-24-1 |
||||||||||
Accession | MI0000231 (change log) | |||||||||
Previous IDs | mmu-mir-189 | |||||||||
Symbol | MGI:Mir24-1 | |||||||||
Description | Mus musculus miR-24-1 stem-loop | |||||||||
Gene family | MIPF0000041; mir-24 | |||||||||
Literature search |
![]()
141 open access papers mention mmu-mir-24-1 | |||||||||
Stem-loop |
g g a ua ucuca 5' cucc gu ccu cugagcuga ucagu u |||| || ||| ||||||||| ||||| u 3' gagg ca gga gacuugacu gguca u a a c -c cacac |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence mmu-miR-24-1-5p |
|
Accession | MIMAT0000218 |
Previous IDs | mmu-miR-189;mmu-miR-24*;mmu-miR-24-1* |
Sequence |
6 - gugccuacugagcugauaucagu - 28 |
Deep sequencing | 24109 reads, 103 experiments |
Evidence | experimental; cloned [2,7], Illumina [8-9] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-24-3p |
|
Accession | MIMAT0000219 |
Previous IDs | mmu-miR-24 |
Sequence |
44 - uggcucaguucagcaggaacag - 65 |
Deep sequencing | 4657101 reads, 107 experiments |
Evidence | experimental; cloned [1-2,4-6], Northern [2], Illumina [7] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12007417
"Identification of tissue-specific microRNAs from mouse"
Curr Biol. 12:735-739(2002).
|
2 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
3 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
4 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
5 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
6 | |
7 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
8 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
9 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|