Stem-loop sequence mmu-mir-24-1

Accession

MI0000231

Previous IDs

mmu-mir-189

Symbol

MGI:Mir24-1

Description

Mus musculus miR-24-1 stem-loop

Gene family

MIPF0000041; mir-24

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-24_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-24 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. miR-24 is conserved in various species, and is clustered with miR-23 and miR-27, on human chromosome 9 and 19. Recently, miR-24 has been shown to suppress expression of two crucial cell cycle control genes, E2F2 and Myc in hematopoietic differentiation and also to promote keratinocyte differentiation by repressing actin-cytoskeleton regulators PAK4, Tsk5 and ArhGAP19.

Stem-loop

    g  g   a         ua     ucuca 
cucc gu ccu cugagcuga  ucagu     u
|||| || ||| |||||||||  |||||     u
gagg ca gga gacuugacu  gguca     u
    a  a   c         -c     cacac 

Deep sequencing

1477937 reads, 97 experiments

Genome context

• Coordinates (GRCm38): chr13: 63301208-63301275 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000076332 ; AC130827.2-002; intron 3

  ENSMUST00000159152 ; 2010111I01Rik-002; intron 3

  ENSMUST00000021911 ; 2010111I01Rik-201; intron 15

  antisense

  ENSMUST00000175000 ; Mir3074-1-201; exon 1

Clustered miRNAs

< 10kb from mmu-mir-24-1

• mmu-mir-23b: chr13: 63300484-63300557 [+]
• mmu-mir-27b: chr13: 63300712-63300784 [+]
• mmu-mir-3074-1: chr13: 63301199-63301283 [-]
• mmu-mir-24-1: chr13: 63301208-63301275 [+]

Database links

• EMBL: AJ459715;MMU459715
• ENTREZGENE: 387142;Mir24-1
• MGI: 2676899;Mir24-1

Mature sequence mmu-miR-24-1-5p

• Accession: MIMAT0000218
• Previous IDs: mmu-miR-189;mmu-miR-24*;mmu-miR-24-1*
• Sequence: 6 - gugccuacugagcugauaucagu - 28
• Deep sequencing: 2693 reads, 79 experiments
• Evidence: experimental; cloned [2,7], Solexa [8-9]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-24-1-5p
  • MICRORNA.ORG:mmu-miR-24-1-5p
  • MIRDB:mmu-miR-24-1-5p
  • RNA22-MMU:mmu-miR-24-1-5p

Mature sequence mmu-miR-24-3p

• Accession: MIMAT0000219
• Previous IDs: mmu-miR-24
• Sequence: 44 - uggcucaguucagcaggaacag - 65
• Deep sequencing: 1275162 reads, 82 experiments
• Evidence: experimental; cloned [1,3,5-7], Northern [3], Solexa [8-9]
• Validated targets:
  • TARBASE:mmu-miR-24-3p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-24-3p
  • MICRORNA.ORG:mmu-miR-24-3p
  • MIRDB:mmu-miR-24-3p
  • RNA22-MMU:mmu-miR-24-3p
  • TARGETSCAN-VERT:mmu-miR-24

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3. PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
4. PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
5. PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
6. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
7. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
8. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
9. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).