Stem-loop sequence mmu-mir-24-1

Accession MI0000231
Previous IDs mmu-mir-189
Symbol MGI:Mir24-1
Description Mus musculus miR-24-1 stem-loop
Gene family MIPF0000041; mir-24
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-24_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-24 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. miR-24 is conserved in various species, and is clustered with miR-23 and miR-27, on human chromosome 9 and 19. Recently, miR-24 has been shown to suppress expression of two crucial cell cycle control genes, E2F2 and Myc in hematopoietic differentiation and also to promote keratinocyte differentiation by repressing actin-cytoskeleton regulators PAK4, Tsk5 and ArhGAP19.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    g  g   a         ua     ucuca 
cucc gu ccu cugagcuga  ucagu     u
|||| || ||| |||||||||  |||||     u
gagg ca gga gacuugacu  gguca     u
    a  a   c         -c     cacac 
Get sequence
Deep sequencing
1477937 reads, 97 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr13: 63301208-63301275 [+]
sense
OTTMUST00000076332 ; AC130827.2-002; intron 3
ENSMUST00000159152 ; 2010111I01Rik-002; intron 3
ENSMUST00000021911 ; 2010111I01Rik-201; intron 15
antisense
ENSMUST00000175000 ; Mir3074-1-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-24-1
mmu-mir-23b chr13: 63300484-63300557 [+]
mmu-mir-27b chr13: 63300712-63300784 [+]
mmu-mir-3074-1 chr13: 63301199-63301283 [-]
mmu-mir-24-1 chr13: 63301208-63301275 [+]
Database links

Mature sequence mmu-miR-24-1-5p

Accession MIMAT0000218
Previous IDs mmu-miR-189;mmu-miR-24*;mmu-miR-24-1*
Sequence

6 - 

gugccuacugagcugauaucagu

 - 28

Get sequence
Deep sequencing 2693 reads, 79 experiments
Evidence experimental; cloned [2,7], Solexa [8-9]
Predicted targets

Mature sequence mmu-miR-24-3p

Accession MIMAT0000219
Previous IDs mmu-miR-24
Sequence

44 - 

uggcucaguucagcaggaacag

 - 65

Get sequence
Deep sequencing 1275162 reads, 82 experiments
Evidence experimental; cloned [1,3,5-7], Northern [3], Solexa [8-9]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
4
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
5
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
6
7
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
8
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
9
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).