Stem-loop sequence mmu-mir-187

Accession MI0000229
Symbol MGI:Mir187
Description Mus musculus miR-187 stem-loop
Gene family MIPF0000078; mir-187
Stem-loop 
uca    a           c  -  c - ug 
   ggcu caacacaggac cg gg g c  c
   |||| ||||||||||| || || | |   
   ccga guuguguucug gc cc c g  u
-gg    c           u  u  c a uc
Get sequence
Deep sequencing
5541 reads, 87 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr18: 24429110-24429170 [-]
intergenic
Database links

Mature sequence mmu-miR-187-5p

Accession MIMAT0016997
Previous IDs mmu-miR-187*
Sequence

3 -  

aggcuacaacacaggacccggg

 - 24

Get sequence
Deep sequencing 1614 reads, 54 experiments
Evidence experimental; Solexa [4]
Predicted targets

Mature sequence mmu-miR-187-3p

Accession MIMAT0000216
Previous IDs mmu-miR-187
Sequence

40 -  

ucgugucuuguguugcagccgg

 - 61

Get sequence
Deep sequencing 3382 reads, 66 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).