Stem-loop sequence mmu-mir-186

Accession MI0000228
Symbol MGI:Mir186
Description Mus musculus miR-186 stem-loop
Gene family MIPF0000109; mir-186
Stem-loop
                u    uu      ucucau 
acuuuccaaagaauuc ccuu  gggcuu      u
|||||||||||||||| ||||  ||||||       
ugaaggguuuuuuaag ggaa  cccgaa      u
                u    -u      uuuuau 
Get sequence
Deep sequencing
567530 reads, 97 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr3: 157544279-157544349 [+]
sense
OTTMUST00000040347 ; Zranb2-004; intron 7
OTTMUST00000040346 ; Zranb2-003; intron 7
OTTMUST00000040345 ; Zranb2-002; intron 8
OTTMUST00000040344 ; Zranb2-001; intron 8
ENSMUST00000152882 ; Zranb2-004; intron 7
ENSMUST00000136928 ; Zranb2-003; intron 7
ENSMUST00000106063 ; Zranb2-202; intron 8
ENSMUST00000029831 ; Zranb2-201; intron 8
ENSMUST00000106057 ; Zranb2-002; intron 8
ENSMUST00000106058 ; Zranb2-001; intron 8
Database links

Mature sequence mmu-miR-186-5p

Accession MIMAT0000215
Previous IDs mmu-miR-186
Sequence

7 - 

caaagaauucuccuuuugggcu

 - 28

Get sequence
Deep sequencing 82957 reads, 82 experiments
Evidence experimental; cloned [1-3], Solexa [4-5]
Predicted targets

Mature sequence mmu-miR-186-3p

Accession MIMAT0004540
Previous IDs mmu-miR-186*
Sequence

46 - 

gcccuaaggugaauuuuuuggg

 - 67

Get sequence
Deep sequencing 1738 reads, 79 experiments
Evidence experimental; cloned [3], Solexa [4-5]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).