|
miRBase |
|
Stem-loop sequence mmu-mir-186 |
|||||
| Accession | MI0000228 | ||||
| Symbol | MGI:Mir186 | ||||
| Description | Mus musculus miR-186 stem-loop | ||||
| Gene family | MIPF0000109; mir-186 | ||||
| Stem-loop |
u uu ucucau acuuuccaaagaauuc ccuu gggcuu u |||||||||||||||| |||| |||||| ugaaggguuuuuuaag ggaa cccgaa u u -u uuuuau |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence mmu-miR-186-5p |
|
| Accession | MIMAT0000215 |
| Previous IDs | mmu-miR-186 |
| Sequence |
7 - caaagaauucuccuuuugggcu - 28 |
| Deep sequencing | 82957 reads, 82 experiments |
| Evidence | experimental; cloned [1-3], Solexa [4-5] |
| Predicted targets |
|
Mature sequence mmu-miR-186-3p |
|
| Accession | MIMAT0004540 |
| Previous IDs | mmu-miR-186* |
| Sequence |
46 - gcccuaaggugaauuuuuuggg - 67 |
| Deep sequencing | 1738 reads, 79 experiments |
| Evidence | experimental; cloned [3], Solexa [4-5] |
| Predicted targets |
|
References |
|
| 1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
| 2 |
PMID:12554860
"Numerous microRNPs in neuronal cells containing novel microRNAs"
RNA. 9:180-186(2003).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|