Stem-loop sequence mmu-mir-186

AccessionMI0000228 (change log)
Symbol MGI:Mir186
DescriptionMus musculus miR-186 stem-loop
Gene family MIPF0000109; mir-186
Stem-loop
                   u    uu      ucucau 
5' acuuuccaaagaauuc ccuu  gggcuu      u
   |||||||||||||||| ||||  ||||||       
3' ugaaggguuuuuuaag ggaa  cccgaa      u
                   u    -u      uuuuau 
Get sequence
Deep sequencing
88128 reads, 386 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 157544279-157544349 [+]
sense
OTTMUST00000040346 ; Zranb2-003; intron 7
OTTMUST00000040347 ; Zranb2-004; intron 7
OTTMUST00000040344 ; Zranb2-001; intron 8
OTTMUST00000040345 ; Zranb2-002; intron 8
ENSMUST00000184802 ; Zranb2-003; intron 7
ENSMUST00000152882 ; Zranb2-004; intron 7
ENSMUST00000106058 ; Zranb2-001; intron 8
ENSMUST00000106057 ; Zranb2-002; intron 8
ENSMUST00000029831 ; Zranb2-201; intron 8
ENSMUST00000106063 ; Zranb2-202; intron 8
Database links

Mature sequence mmu-miR-186-5p

Accession MIMAT0000215
Previous IDsmmu-miR-186
Sequence

7 - 

caaagaauucuccuuuugggcu

 - 28

Get sequence
Deep sequencing86052 reads, 76 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-186-3p

Accession MIMAT0004540
Previous IDsmmu-miR-186*
Sequence

46 - 

gcccuaaggugaauuuuuuggg

 - 67

Get sequence
Deep sequencing2076 reads, 74 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).