Stem-loop sequence mmu-mir-185

Accession MI0000227
Symbol MGI:Mir185
Description Mus musculus miR-185 stem-loop
Gene family MIPF0000202; mir-185
Stem-loop
      ug   a     g         au  uc 
agggau  gag gaaag caguuccug  gg  c
||||||  ||| ||||| |||||||||  ||   
uuccug  cuc cuuuc gucggggac  cc  c
      gu   -     g         --  uc 
Get sequence
Deep sequencing
646370 reads, 96 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr16: 18327401-18327465 [-]
sense
OTTMUST00000064223 ; RP23-47O21.5-003; intron 1
OTTMUST00000064868 ; RP23-47O21.5-010; intron 1
OTTMUST00000064224 ; RP23-47O21.5-004; intron 1
OTTMUST00000064221 ; RP23-47O21.5-001; intron 1
ENSMUST00000083530 ; Mir185-201; exon 1
ENSMUST00000134385 ; D16H22S680E-003; intron 1
ENSMUST00000130752 ; D16H22S680E-010; intron 1
ENSMUST00000125287 ; D16H22S680E-004; intron 1
ENSMUST00000115628 ; D16H22S680E-001; intron 1
Database links

Mature sequence mmu-miR-185-5p

Accession MIMAT0000214
Previous IDs mmu-miR-185
Sequence

7 - 

uggagagaaaggcaguuccuga

 - 28

Get sequence
Deep sequencing 525467 reads, 81 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-185-3p

Accession MIMAT0016996
Previous IDs mmu-miR-185*
Sequence

41 - 

aggggcuggcuuuccucuggu

 - 61

Get sequence
Deep sequencing 1444 reads, 76 experiments
Evidence experimental; Solexa [4]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).