|
miRBase |
|
Stem-loop sequence mmu-mir-185 |
|||||
| Accession | MI0000227 | ||||
| Symbol | MGI:Mir185 | ||||
| Description | Mus musculus miR-185 stem-loop | ||||
| Gene family | MIPF0000202; mir-185 | ||||
| Stem-loop |
ug a g au uc agggau gag gaaag caguuccug gg c |||||| ||| ||||| ||||||||| || uuccug cuc cuuuc gucggggac cc c gu - g -- uc |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence mmu-miR-185-5p |
|
| Accession | MIMAT0000214 |
| Previous IDs | mmu-miR-185 |
| Sequence |
7 - uggagagaaaggcaguuccuga - 28 |
| Deep sequencing | 525467 reads, 81 experiments |
| Evidence | experimental; cloned [1-2], Solexa [3-4] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence mmu-miR-185-3p |
|
| Accession | MIMAT0016996 |
| Previous IDs | mmu-miR-185* |
| Sequence |
41 - aggggcuggcuuuccucuggu - 61 |
| Deep sequencing | 1444 reads, 76 experiments |
| Evidence | experimental; Solexa [4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|