Stem-loop sequence mmu-mir-184

AccessionMI0000226 (change log)
Symbol MGI:Mir184
DescriptionMus musculus miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

47 open access papers mention mmu-mir-184
(584 sentences)

Stem-loop
      u         c      ag     -    ug 
5' ccu uccuuauca uuuucc  ccagc uuug  a
   ||| ||||||||| ||||||  ||||| ||||   
3' gga gggaauagu aagagg  gguug gaau  c
      u         c      ca     u    cu 
Get sequence
Deep sequencing
127250 reads, 600 reads per million, 99 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 89802260-89802328 [-]
intergenic
Database links

Mature sequence mmu-miR-184-5p

Accession MIMAT0022690
Sequence

6 - 

ccuuaucacuuuuccagccagc

 - 27

Get sequence
Deep sequencing15 reads, 10 experiments
Evidence not experimental
Predicted targets

Mature sequence mmu-miR-184-3p

Accession MIMAT0000213
Previous IDsmmu-miR-184
Sequence

45 - 

uggacggagaacugauaagggu

 - 66

Get sequence
Deep sequencing127232 reads, 96 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).