Stem-loop sequence mmu-mir-184

Accession MI0000226
Symbol MGI:Mir184
Description Mus musculus miR-184 stem-loop
Gene family MIPF0000059; mir-184
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-184. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-184 microRNA is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. Several targets for miR-184 have been described, including that of mediators of neurological development, apoptosis and it has been suggested that miR-184 plays an essential role in development. MicroRNAs can bind to the three prime untranslated region (3’UTR) of the target messenger RNA (mRNA). Binding of the miRNA can hinder translation of mRNA by promoting degradation or inducing deadenylation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u         c      ag     -    ug 
ccu uccuuauca uuuucc  ccagc uuug  a
||| ||||||||| ||||||  ||||| ||||   
gga gggaauagu aagagg  gguug gaau  c
   u         c      ca     u    cu 
Get sequence
Deep sequencing
92197 reads, 86 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr9: 89802260-89802328 [-]
intergenic
Database links

Mature sequence mmu-miR-184-5p

Accession MIMAT0022690
Sequence

6 - 

ccuuaucacuuuuccagccagc

 - 27

Get sequence
Evidence not experimental
Predicted targets

Mature sequence mmu-miR-184-3p

Accession MIMAT0000213
Previous IDs mmu-miR-184
Sequence

45 - 

uggacggagaacugauaagggu

 - 66

Get sequence
Deep sequencing 4004 reads, 74 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Validated targets
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).