Stem-loop sequence mmu-mir-183

AccessionMI0000225 (change log)
Symbol MGI:Mir183
DescriptionMus musculus miR-183 stem-loop
Gene family MIPF0000066; mir-183
Stem-loop
       g      --ac     ga        --   ac 
5' cugu uauggc    uggua  auucacug  uga  a
   |||| ||||||    |||||  ||||||||  |||   
3' gaca auaccg    gccau  uaagugac  acu  g
       a      ggaa     --        ug   cu 
Get sequence
Deep sequencing
33900 reads, 199 reads per million, 69 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 30169668-30169737 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-183
mmu-mir-183chr6: 30169668-30169737 [-]
mmu-mir-96chr6: 30169446-30169551 [-]
mmu-mir-182chr6: 30165918-30165992 [-]
Database links

Mature sequence mmu-miR-183-5p

Accession MIMAT0000212
Previous IDsmmu-miR-183
Sequence

6 - 

uauggcacugguagaauucacu

 - 27

Get sequence
Deep sequencing29674 reads, 69 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-183-3p

Accession MIMAT0004539
Previous IDsmmu-miR-183*
Sequence

45 - 

gugaauuaccgaagggccauaa

 - 66

Get sequence
Deep sequencing4224 reads, 57 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).