Stem-loop sequence mmu-mir-182

Accession MI0000224
Symbol MGI:Mir182
Description Mus musculus miR-182 stem-loop
Gene family MIPF0000116; mir-182
Stem-loop
     uu       u -g      uca      uaaggu 
accau  uuggcaa g  uagaac   caccgg      a
|||||  ||||||| |  ||||||   ||||||       
uggua  aaccguu c  aucuug   guggcc      a
     uc       - ag      ---      cagggu 
Get sequence
Deep sequencing
96248 reads, 94 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr6: 30165918-30165992 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-182
mmu-mir-183 chr6: 30169668-30169737 [-]
mmu-mir-96 chr6: 30169446-30169551 [-]
mmu-mir-182 chr6: 30165918-30165992 [-]
Database links

Mature sequence mmu-miR-182-5p

Accession MIMAT0000211
Previous IDs mmu-miR-182
Sequence

7 - 

uuuggcaaugguagaacucacaccg

 - 31

Get sequence
Deep sequencing 48273 reads, 79 experiments
Evidence experimental; cloned [1-3], Solexa [4,6]
Predicted targets

Mature sequence mmu-miR-182-3p

Accession MIMAT0016995
Previous IDs mmu-miR-182*
Sequence

50 - 

gugguucuagacuugccaacu

 - 70

Get sequence
Deep sequencing 293 reads, 38 experiments
Evidence experimental; 454 [5], Solexa [6]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).