|
miRBase |
|
Stem-loop sequence mmu-mir-182 |
||||||||
| Accession | MI0000224 | |||||||
| Symbol | MGI:Mir182 | |||||||
| Description | Mus musculus miR-182 stem-loop | |||||||
| Gene family | MIPF0000116; mir-182 | |||||||
| Stem-loop |
uu u -g uca uaaggu accau uuggcaa g uagaac caccgg a ||||| ||||||| | |||||| |||||| uggua aaccguu c aucuug guggcc a uc - ag --- cagggu |
|||||||
| Deep sequencing |
| |||||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links | ||||||||
Mature sequence mmu-miR-182-5p |
|
| Accession | MIMAT0000211 |
| Previous IDs | mmu-miR-182 |
| Sequence |
7 - uuuggcaaugguagaacucacaccg - 31 |
| Deep sequencing | 48273 reads, 79 experiments |
| Evidence | experimental; cloned [1-3], Solexa [4,6] |
| Predicted targets |
|
Mature sequence mmu-miR-182-3p |
|
| Accession | MIMAT0016995 |
| Previous IDs | mmu-miR-182* |
| Sequence |
50 - gugguucuagacuugccaacu - 70 |
| Deep sequencing | 293 reads, 38 experiments |
| Evidence | experimental; 454 [5], Solexa [6] |
| Predicted targets |
|
References |
|
| 1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
| 2 |
PMID:15538371
"A pancreatic islet-specific microRNA regulates insulin secretion"
Nature. 432:226-230(2004).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
| 6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|