Stem-loop sequence mmu-mir-182

AccessionMI0000224 (change log)
Symbol MGI:Mir182
DescriptionMus musculus miR-182 stem-loop
Gene family MIPF0000116; mir-182
Stem-loop
        uu       u -g      uca      uaaggu 
5' accau  uuggcaa g  uagaac   caccgg      a
   |||||  ||||||| |  ||||||   ||||||       
3' uggua  aaccguu c  aucuug   guggcc      a
        uc       - ag      ---      cagggu 
Get sequence
Deep sequencing
52963 reads, 216 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 30165918-30165992 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-182
mmu-mir-183chr6: 30169668-30169737 [-]
mmu-mir-96chr6: 30169446-30169551 [-]
mmu-mir-182chr6: 30165918-30165992 [-]
Database links

Mature sequence mmu-miR-182-5p

Accession MIMAT0000211
Previous IDsmmu-miR-182
Sequence

7 - 

uuuggcaaugguagaacucacaccg

 - 31

Get sequence
Deep sequencing52619 reads, 73 experiments
Evidence experimental; cloned [1-3], Illumina [4,6]
Database links
Predicted targets

Mature sequence mmu-miR-182-3p

Accession MIMAT0016995
Previous IDsmmu-miR-182*
Sequence

50 - 

gugguucuagacuugccaacu

 - 70

Get sequence
Deep sequencing305 reads, 39 experiments
Evidence experimental; 454 [5], Illumina [6]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).