Stem-loop sequence mmu-mir-181a-2

AccessionMI0000223 (change log)
Previous IDsmmu-mir-181;mmu-mir-181a
Symbol MGI:Mir181a-2
DescriptionMus musculus miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

206 open access papers mention mmu-mir-181a-2
(1748 sentences)

Stem-loop
      u  a   u      cu       a    gggauuc 
5' cca gg aca ucaacg  gucggug guuu       a
   ||| || ||| ||||||  ||||||| ||||       a
3' ggu cc ugu aguugc  cagccac caaa       a
      u  a   c      --       -    aaaacaa 
Get sequence
Deep sequencing
5142313 reads, 7.1e+03 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 38852735-38852810 [+]
antisense
OTTMUST00000030867 ; Nr6a1-002; intron 2
OTTMUST00000029378 ; Nr6a1-001; intron 4
ENSMUST00000142130 ; Nr6a1-002; intron 2
ENSMUST00000076275 ; Nr6a1-201; intron 3
ENSMUST00000112877 ; Nr6a1-001; intron 4
Clustered miRNAs
< 10kb from mmu-mir-181a-2
mmu-mir-181a-2chr2: 38852735-38852810 [+]
mmu-mir-181b-2chr2: 38853830-38853918 [+]
Database links

Mature sequence mmu-miR-181a-5p

Accession MIMAT0000210
Previous IDsmmu-miR-181a
Sequence

7 - 

aacauucaacgcugucggugagu

 - 29

Get sequence
Deep sequencing10154990 reads, 107 experiments
Evidence experimental; cloned [2,4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-181a-2-3p

Accession MIMAT0005443
Previous IDsmmu-miR-181a-2*
Sequence

51 - 

accaccgaccguugacuguacc

 - 72

Get sequence
Deep sequencing64988 reads, 98 experiments
Evidence experimental; cloned [5], Illumina [6-7]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).