Stem-loop sequence mmu-mir-129-1

AccessionMI0000222 (change log)
Previous IDsmmu-mir-129b
Symbol MGI:Mir129-1
DescriptionMus musculus miR-129-1 stem-loop
Gene family MIPF0000073; mir-129
Literature search

52 open access papers mention mmu-mir-129-1
(511 sentences)

Stem-loop
        -       c   cu      g   uu  -  c 
5' uggau cuuuuug ggu  gggcuu cug  cu cu g
   ||||| ||||||| |||  |||||| |||  || ||  
3' aucua gaaaaac cca  cccgaa gac  ga ga a
        u       c   uu      g   -u  u  c 
Get sequence
Deep sequencing
208757 reads, 209 reads per million, 102 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 29022619-29022691 [+]
intergenic
Database links

Mature sequence mmu-miR-129-5p

Accession MIMAT0000209
Previous IDsmmu-miR-129
Sequence

6 - 

cuuuuugcggucugggcuugc

 - 26

Get sequence
Deep sequencing325625 reads, 97 experiments
Evidence experimental; cloned [1,3-4], Illumina [5-6]
Database links
Predicted targets

Mature sequence mmu-miR-129-1-3p

Accession MIMAT0016994
Sequence

49 - 

aagcccuuaccccaaaaaguau

 - 70

Get sequence
Deep sequencing45758 reads, 96 experiments
Evidence experimental; Illumina [6]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).