Stem-loop sequence mmu-mir-129-1

Accession MI0000222
Previous IDs mmu-mir-129b
Symbol MGI:Mir129-1
Description Mus musculus miR-129-1 stem-loop
Gene family MIPF0000073; mir-129
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-129_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-129 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. This microRNA was first experimentally characterised in mouse and homologues have since been discovered in several other species, such as humans, rats and zebrafish. The mature sequence is excised by the Dicer enzyme from the 5' arm of the hairpin. It was elucidated by Calin et al. that miR-129-1 is located in a fragile site region of the human genome near a specific site, FRA7H in chromosome 7q32, which is a site commonly deleted in many cancers. miR-129-2 is located in 11p11.2.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     -       c   cu      g   uu  -  c 
uggau cuuuuug ggu  gggcuu cug  cu cu g
||||| ||||||| |||  |||||| |||  || ||  
aucua gaaaaac cca  cccgaa gac  ga ga a
     u       c   uu      g   -u  u  c 
Get sequence
Deep sequencing
68624 reads, 94 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr6: 29022619-29022691 [+]
intergenic
Database links

Mature sequence mmu-miR-129-5p

Accession MIMAT0000209
Previous IDs mmu-miR-129
Sequence

6 - 

cuuuuugcggucugggcuugc

 - 26

Get sequence
Deep sequencing 51874 reads, 76 experiments
Evidence experimental; cloned [1,3-4], Solexa [5-6]
Predicted targets

Mature sequence mmu-miR-129-1-3p

Accession MIMAT0016994
Sequence

49 - 

aagcccuuaccccaaaaaguau

 - 70

Get sequence
Deep sequencing 41361 reads, 72 experiments
Evidence experimental; Solexa [6]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).