Stem-loop sequence mmu-mir-10b

AccessionMI0000221 (change log)
Symbol MGI:Mir10b
DescriptionMus musculus miR-10b stem-loop
Gene family MIPF0000033; mir-10
Literature search

133 open access papers mention mmu-mir-10b
(849 sentences)

Stem-loop
        a    g     c          -ug  ac 
5' uauau cccu uagaa cgaauuugug   gu  c
   ||||| |||| ||||| ||||||||||   ||   
3' auaua gggg aucuu gcuuagacac   ua  c
        a    -     a          uga  ca 
Get sequence
Deep sequencing
18876736 reads, 2.29e+04 reads per million, 110 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The sequence of mouse miR-10b, as reported by Lagos-Quintana et al. [1], is offset by 2 nt in the 3' direction with respect to sequences cloned from human (MI0000267) and zebrafish (MI0001364). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 74726070-74726137 [+]
sense
OTTMUST00000040120 ; Hoxd3-001; intron 1
OTTMUST00000040121 ; Hoxd3-002; intron 5
ENSMUST00000111983 ; Hoxd3-001; intron 1
ENSMUST00000083566 ; Mir10b-201; exon 1
ENSMUST00000047904 ; Hoxd3-201; intron 4
ENSMUST00000144040 ; Hoxd3-002; intron 5
Database links

Mature sequence mmu-miR-10b-5p

Accession MIMAT0000208
Previous IDsmmu-miR-10b
Sequence

5 - 

uacccuguagaaccgaauuugug

 - 27

Get sequence
Deep sequencing18866151 reads, 109 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-10b-3p

Accession MIMAT0004538
Previous IDsmmu-miR-10b*
Sequence

45 - 

cagauucgauucuaggggaaua

 - 66

Get sequence
Deep sequencing10582 reads, 65 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).