Stem-loop sequence ath-MIR159b

Accession MI0000218
Description Arabidopsis thaliana miR159b stem-loop
Gene family MIPF0000010; MIR159
Stem-loop 
------g            ga       u       uu   ------    ug    -      g  a  c     auc      -----         aau       
       gaagagcuccuu  aguucaa ggagggu  agc      aggg  aagu aaagcu cu ag uaugg   ccauaa     gccuuauca   ucaaua 
       ||||||||||||  ||||||| |||||||  |||      ||||  |||| |||||| || || |||||   ||||||     |||||||||   ||||| u
       cuucucgaggga  uuagguu cuucuca  ucg      uccc  uuca uuucga ga uc auacc   gguauu     uggaauagu   aguuaa 
cucucua            ag       u       cu   guaauu    ca    c      g  c  u     gua      uuuuu         ---
Get sequence
Deep sequencing
146487 reads, 8 experiments
Comments

Reference [1] described the discovery of MIR159b, but referred to the sequence by the internal identifier MIR40b. This sequence is not related to C. elegans miR-40. MIR159b is found on chromosome 1 in Arabidopsis thaliana [2] and is thought to target mRNAs coding for MYB proteins which are known to bind to the promoter of the floral meristem identity gene LEAFY [3].

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr1: 6220646-6220841 [+]
intergenic
Database links

Mature sequence ath-miR159b

Accession MIMAT0000207
Sequence

168 -  

uuuggauugaagggagcucuu

 - 188

Get sequence
Deep sequencing 146136 reads, 8 experiments
Evidence experimental; cloned [1-2,4], 5'RACE [4], 454 [5-6], MPSS [5], Solexa [7]

References

1
PMID:12226481 "Short RNAs can identify new candidate transposable element families in Arabidopsis" Mette MF, van der Winden J, Matzke M, Matzke AJ Plant Physiol. 130:6-9(2002).
2
PMID:12225663 "CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana" Park W, Li J, Song R, Messing J, Chen X Curr Biol. 12:1484-1495(2002).
3
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
4
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
5
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
6
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
7
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).