Stem-loop sequence ath-MIR173

Accession MI0000217
Description Arabidopsis thaliana miR173 stem-loop
Gene family MIPF0001175; MIR173
Stem-loop 
     a            g      a      u  ucaaaaaag   u  u 
uaagu cuuucgcuugca agagaa ucacag gg         uug ag u
||||| |||||||||||| |||||| |||||| ||         ||| ||  
guucg gaaagcgaaugu ucucuu aguguc cc         aau uc u
     a            g      -      u  uuucucuga   -  u
Get sequence
Deep sequencing
1485 reads, 8 experiments
Comments

MIR173 is found on chromosome 3 in Arabidopsis thaliana and is thought to target mRNAs coding for a protein of unknown function (At3g28460) [1].

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr3: 8236153-8236254 [+]
intergenic

Mature sequence ath-miR173-5p

Accession MIMAT0000206
Previous IDs ath-miR173
Sequence

9 -  

uucgcuugcagagagaaaucac

 - 30

Get sequence
Deep sequencing 1349 reads, 8 experiments
Evidence experimental; cloned [1-2], 454 [3-4], MPSS [3], Solexa [5]
Validated targets

Mature sequence ath-miR173-3p

Accession MIMAT0022843
Sequence

75 -  

ugauucucuguguaagcgaaa

 - 95

Get sequence
Deep sequencing 136 reads, 8 experiments
Evidence experimental; Solexa [6]

References

1
PMID:12225663 "CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana" Park W, Li J, Song R, Messing J, Chen X Curr Biol. 12:1484-1495(2002).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).
6
PMID:22221297 "Global analysis of non-coding small RNAs in Arabidopsis in response to jasmonate treatment by deep sequencing technology" Zhang B, Jin Z, Xie D J Integr Plant Biol. 54:73-86(2012).