Stem-loop sequence ath-MIR171a

AccessionMI0000214 (change log)
Previous IDsath-MIR171
DescriptionArabidopsis thaliana miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

30 open access papers mention ath-MIR171a
(149 sentences)

Stem-loop
             cc  uu         c       c      cuuaccugaccacacacguag 
5' augagagagu  cu  gauauuggc ugguuca ucagau                     a
   ||||||||||  ||  ||||||||| ||||||| ||||||                      
3' ugcucucuca  ga  cuauaaccg gccgagu agucua                     u
             -u  cu         c       u      uuagaucucucuuauuacaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR171 is thought, like miR170, to target mRNAs coding for GRAS domain or SCARECROW-like proteins, a family of transcription factors whose members have been implicated in radial patterning in roots, signaling by the phytohormone gibberellin, and light signaling [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 19073434-19073556 [+]
intergenic
Database links

Mature sequence ath-miR171a-5p

Accession MIMAT0031888
Sequence

19 - 

uauuggccugguucacucaga

 - 39

Get sequence
Evidence not experimental

Mature sequence ath-miR171a-3p

Accession MIMAT0000202
Previous IDsath-miR171a
Sequence

88 - 

ugauugagccgcgccaauauc

 - 108

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).