Stem-loop sequence ath-MIR169a

AccessionMI0000212 (change log)
Previous IDsath-MIR169
DescriptionArabidopsis thaliana miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

35 open access papers mention ath-MIR169a
(174 sentences)

Stem-loop
         -           c         ug           uaaaugaucuuucuuuauacucuauuaagacaauuuaguuucaaacuuuuuuuuuuuuuuuuuuuugaagg 
5' gugacg aaaguagugug agccaagga  acuugccgauu                                                                       a
   |||||| ||||||||||| |||||||||  |||||||||||                                                                       u
3' cgcugu uuucauugcac ucgguuccu  ugaacggcuag                                                                       u
         g           a         gu           uacaaugaaaaagaaaaaccaaaauauauagaacauaaaauaugccuuauuauauaggauuaaagaaggac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR169 is thought to target mRNAs coding for CCAAT binding factor (CBF)-HAP2-like proteins [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr3: 4358994-4359219 [-]
intergenic
Database links

Mature sequence ath-miR169a-5p

Accession MIMAT0000200
Previous IDsath-miR169a
Sequence

18 - 

cagccaaggaugacuugccga

 - 38

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR169a-3p

Accession MIMAT0031886
Sequence

190 - 

ggcaaguuguccuuggcuac

 - 209

Get sequence
Evidence not experimental

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).