Stem-loop sequence ath-MIR166e

Accession MI0000205
Description Arabidopsis thaliana miR166e stem-loop
Gene family MIPF0000004; MIR166
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-166_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The plant mir-166 microRNA precursor is a small non-coding RNA gene. This microRNA (miRNA) has now been predicted or experimentally confirmed in a wide range of plant species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The mature products are thought to have regulatory roles through complementarity to messenger RNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
u           uu      ca   g c c      uagaucuauauuugauuauauauauaugucucuu 
 ugaggggaaug  gucugg  cga g c uuaacu                                  c
 |||||||||||  ||||||  ||| | | ||||||                                  u
 acuccccuuac  cggacc  gcu c g aauugg                                  u
a           uu      ag   g a u      cauuuuacuaguaaguacauaucugauuacuuau
Get sequence
Deep sequencing
12282 reads, 8 experiments
Comments

MIR166e is found on chromosome 5 in Arabidopsis thaliana [1] and, like miR165, is thought to target mRNAs coding for HD-Zip transcription factors including Phabulosa (PHB) and Phavoluta (PHV) that regulate axillary meristem initiation and leaf development [2].

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr5: 16775520-16775662 [-]
intergenic
Database links

Mature sequence ath-miR166e

Accession MIMAT0000193
Sequence

119 -  

ucggaccaggcuucauucccc

 - 139

Get sequence
Deep sequencing 12170 reads, 8 experiments
Evidence experimental; cloned [1,3], Northern [1], 3'RACE [3], 454 [4-5], MPSS [4], Solexa [6]

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).