Stem-loop sequence ath-MIR165b

AccessionMI0000200 (change log)
DescriptionArabidopsis thaliana miR165b stem-loop
Gene family MIPF0000004; MIR166
Literature search

44 open access papers mention ath-MIR165b
(246 sentences)

Stem-loop
   u  --a     u   -u -     u    a   uu      a    g        aaac    acac    uu      u   a          g 
5'  ga   gaggc auu  c uguug gggg aug  guuugg ucga gauaucau    gcau    augu  auaugu aug ugcauuauau a
    ||   ||||| |||  | ||||| |||| |||  |||||| |||| ||||||||    ||||    ||||  |||||| ||| |||||||||| c
3'  cu   uuccg uaa  g acaac cccc uac  cggacc ggcu cuauggua    cgua    uaca  uauaua uac auguaaugua u
   a  aac     u   uu u     u    c   uu      a    g        -cac    --ca    --      -   -          g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR165b is thought to target mRNAs coding for HD-Zip transcription factors including Phabulosa (PHB) and Phavoluta (PHV) that regulate axillary meristem initiation and leaf development [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 369831-370012 [-]
intergenic
Database links

Mature sequence ath-miR165b

Accession MIMAT0000188
Sequence

137 - 

ucggaccaggcuucauccccc

 - 157

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 454 [4-5], MPSS [4], Illumina [6]

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).