Stem-loop sequence ath-MIR164b

AccessionMI0000198 (change log)
DescriptionArabidopsis thaliana miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

43 open access papers mention ath-MIR164b
(255 sentences)

Stem-loop
        a    ca         cauu          a    ----   u    c    --a      g     a     a 
5' gaugg gaag  gggcacgug    acuagcucau uaua    cac cuca caca   augcgu uauau ugcgg a
   ||||| ||||  |||||||||    |||||||||| ||||    ||| |||| ||||   |||||| ||||| |||||  
3' cuacc cuuc  cccguguac    ugauugagua guau    gug gagu gugu   ugugua auaua guguu u
        a    ua         uucu          g    agua   u    u    gug      g     -     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR164b is thought to target mRNAs coding for NAC domain containing proteins such as Cup-Shaped Cotyledon 2 (CUC2) which is required for shoot apical meristem formation [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 287584-287736 [+]
intergenic
Database links

Mature sequence ath-miR164b-5p

Accession MIMAT0000186
Previous IDsath-miR164b
Sequence

3 - 

uggagaagcagggcacgugca

 - 23

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR164b-3p

Accession MIMAT0031878
Sequence

133 - 

caugugcccaucuucaccauc

 - 153

Get sequence
Evidence not experimental

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).