Stem-loop sequence ath-MIR163

AccessionMI0000196 (change log)
DescriptionArabidopsis thaliana miR163 stem-loop
Gene family MIPF0001116; MIR163
Literature search

11 open access papers mention ath-MIR163
(144 sentences)

   acccgguggauaaaaucgaguuccaaccucuucaacgacaacgauuucaacacucucuuccaggaacaacuuccuccaggcagaugauacuaaagugcuggaguuccc      ugag  u     cau     aa     -a      a      ----gg     -   a 
5'                                                                                                             gguucc    ag gaguc   aucaa  ugcgc  uucguu ucacuu      uugaa ccc u
                                                                                                               ||||||    || |||||   |||||  |||||  |||||| ||||||      ||||| ||| u
3'                                                                                                             ccaagg    uc cucag   uaguu  augcg  agguaa agugga      aauuu ggg u
   ----ugugcccccuauuauagcuucaagguucaggagaaguugcugaaaucguagaugcuaaauucgugacgcgucaaugaagaagcuggcacgagaaggauucuucu      ugca  -     ---     -a     ca      -      gguuua     a   g 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 24884066-24884396 [+]
Database links

Mature sequence ath-miR163

Accession MIMAT0000184

294 - 


 - 317

Get sequence
Evidence experimental; cloned [1-2], Northern [1], 5'RACE [2], 454 [3-4], MPSS [3], Illumina [5]


PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).