Stem-loop sequence ath-MIR162a

AccessionMI0000194 (change log)
DescriptionArabidopsis thaliana miR162a stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

17 open access papers mention ath-MIR162a
(49 sentences)

Stem-loop
   u   ug -     -  - ug    ----u       g    c    c        c   c   gaac    u 
5'  agu  g aagaa ga g  agag     cgcugga gcag gguu aucgaucu uuc ugu    acau a
    |||  | ||||| || |  ||||     ||||||| |||| |||| |||||||| ||| |||    |||| a
3'  uca  u uucuu cu u  ucuc     gcgaccu cguc ccaa uagcuaga aag acg    ugua a
   u   gu a     u  a gu    cguuu       a    u    a        u   u   aaaa    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 2634905-2635044 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR162a
ath-MIR834chr5: 2641426-2641674 [-]
ath-MIR162achr5: 2634905-2635044 [-]
Database links

Mature sequence ath-miR162a-5p

Accession MIMAT0031876
Sequence

26 - 

uggaggcagcgguucaucgauc

 - 47

Get sequence
Evidence not experimental

Mature sequence ath-miR162a-3p

Accession MIMAT0000182
Previous IDsath-miR162a
Sequence

89 - 

ucgauaaaccucugcauccag

 - 109

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 3'RACE [3], 5'RACE [3], 454 [4-5], MPSS [4]

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).