Stem-loop sequence ath-MIR161

Accession MI0000193
Description Arabidopsis thaliana miR161 stem-loop
Gene family MIPF0000455; MIR161
Stem-loop 
u    ga    gg      ac   uuuau     c   c      u            c         cc    uuuu     ----        
 gcuu  ucuc  uuuuug  cag     ugcgu gau aaugca ugaaagugacua aucgggguu  gauu    uuguu    cuucaua 
 ||||  ||||  ||||||  |||     ||||| ||| |||||| |||||||||||| |||||||||  ||||    |||||    |||||| u
 cgaa  aggg  aaaaau  guu     acgua cua uuacgu acuuucacugau uggucccaa  cuaa    gacaa    gaaguag 
a    -a    ag      --   ----u     a   a      c            u         --    ---u     aggc
Get sequence
Deep sequencing
176186 reads, 8 experiments
Comments

MIR161 is found on chromosome 1 in Arabidopsis thaliana [1] and is thought to target mRNAs coding for PPR repeat proteins [2].

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr1: 17825685-17825857 [+]
intergenic
Database links

Mature sequence ath-miR161.2

Accession MIMAT0006779
Sequence

38 -  

ucaaugcauugaaagugacua

 - 58

Get sequence
Deep sequencing 175282 reads, 8 experiments
Evidence experimental; cloned [3], PARE [6], Solexa [7]

Mature sequence ath-miR161.1

Accession MIMAT0000181
Previous IDs ath-miR161
Sequence

47 -  

ugaaagugacuacaucggggu

 - 67

Get sequence
Deep sequencing 175562 reads, 8 experiments
Evidence experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [5], Solexa [7]

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
5
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
6
PMID:18542052 "Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends" German MA, Pillay M, Jeong DH, Hetawal A, Luo S, Janardhanan P, Kannan V, Rymarquis LA, Nobuta K, German R, De Paoli E, Lu C, Schroth G, Meyers BC, Green PJ Nat Biotechnol. 26:941-946(2008).
7
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).