miRNA Entry for MI0000190

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

In molecular biology, mir-160 is a microRNA that has been predicted or experimentally confirmed in a range of plant species including Arabidopsis thaliana (mouse-ear cress) and Oryza sativa (rice). miR-160 is predicted to bind complementary sites in the untranslated regions of auxin response factor genes to regulate their expression. The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 5' arm of the hairpin. Specifically, 3 of A. thaliana's 23 auxin-response factor genes are thought to be post-transcriptionally regulated by mir-160. When one of these targets (ARF17) is manipulated to become miRNA-resistant, several developmental defects can be observed in the host plant. This experiment has been repeated with another mir-160 target, ARF10, and results highlighted a regulatory role in post-embryonic development and seed germination.

mir-160 microRNA precursor family

Predicted secondary structure and sequence conservation of mir-160
Identifiers
Symbol	mir-160
Rfam	RF00247
miRBase	MI0000190
miRBase family	MIPF0000032
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035195 0035068
SO	0001244

In molecular biology, mir-160 is a microRNA that has been predicted or experimentally confirmed in a range of plant species including Arabidopsis thaliana (mouse-ear cress) and Oryza sativa (rice).^[1] miR-160 is predicted to bind complementary sites in the untranslated regions of auxin response factor genes to regulate their expression.^[2] The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 5' arm of the hairpin.

Specifically, 3 of A. thaliana's 23 auxin-response factor genes are thought to be post-transcriptionally regulated by mir-160.^[3]^[4] When one of these targets (ARF17) is manipulated to become miRNA-resistant, several developmental defects can be observed in the host plant.^[3] This experiment has been repeated with another mir-160 target, ARF10, and results highlighted a regulatory role in post-embryonic development and seed germination.^[5]

[edit] References

^ "miRNA gene family: MIR160". mirBASE. University of Manchester. http://microrna.sanger.ac.uk/cgi-bin/sequences/mirna_summary.pl?fam=MIPF0000032. Retrieved 5 September 2011.
^ Rhoades, MW; Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP (2002). "Prediction of plant microRNA targets". Cell 110 (4): 513–520. doi:10.1016/S0092-8674(02)00863-2. PMID 12202040.
^ ^a ^b Mallory, AC; Bartel, DP, Bartel, B (2005 May). "MicroRNA-directed regulation of Arabidopsis AUXIN RESPONSE FACTOR17 is essential for proper development and modulates expression of early auxin response genes.". The Plant cell 17 (5): 1360–75. PMID 15829600.
^ Liu, X; Huang, J, Wang, Y, Khanna, K, Xie, Z, Owen, HA, Zhao, D (2010 May). "The role of floral organs in carpels, an Arabidopsis loss-of-function mutation in MicroRNA160a, in organogenesis and the mechanism regulating its expression.". The Plant journal : for cell and molecular biology 62 (3): 416–28. PMID 20136729.
^ Liu, PP; Montgomery, TA, Fahlgren, N, Kasschau, KD, Nonogaki, H, Carrington, JC (2007 Oct). "Repression of AUXIN RESPONSE FACTOR10 by microRNA160 is critical for seed germination and post-germination stages.". The Plant journal : for cell and molecular biology 52 (1): 133–46. PMID 17672844.

[edit] External links

v t e miRNA precursor families

1-100	1 2 6 7 8/141/200 9/79 10 15 16 17 19 21 22 24 26 29 30 31 33 34 46/47/281 92 96

101-200	101 103/107 122 124 126 127 129 130 132 133 134 135 137 138 143 144 145 146 148/152 150 155 156 160 166 172 181 184 191 192/215 194 196 199 200

201+	203 205 208 210 214 218 219 221 223 224 296 338 395 399 433 451

Other	BART1 BART2 BHRF1-1 BHRF1-2 BHRF1-3 Let-7 Lin-4 Lsy-6

This molecular or cell biology article is a stub. You can help Wikipedia by expanding it.

Mature sequence ath-miR160a
Accession	MIMAT0000178
Sequence	4 - ugccuggcucccuguaugcca - 24 Get sequence
Deep sequencing	14250 reads, 8 experiments
Evidence	experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Solexa [6]
Validated targets	TARBASE:ath-miR160a

References
1	PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2	PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3	PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4	PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5	PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6	PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).

miRBase

Stem-loop sequence ath-MIR160a

[edit] References

[edit] External links

Mature sequence ath-miR160a

References