Stem-loop sequence ath-MIR157a

AccessionMI0000184 (change log)
DescriptionArabidopsis thaliana miR157a stem-loop
Gene family MIPF0000008; MIR156
Literature search

18 open access papers mention ath-MIR157a
(219 sentences)

Stem-loop
   -   u         -a             u  -      a   uuc    c 
5'  gug ugacagaag  uagagagcacaga ga ugagau caa   ggag a
    ||| |||||||||  ||||||||||||| || |||||| |||   ||||  
3'  cac acugucuuc  aucucucguguuu cu auucua guu   ucuu u
   c   u         cg             c  c      c   ---    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR157a is thought, like the miR156 family, to target mRNAs coding for proteins containing the Squamosa-promoter Binding Protein (SBP) box [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 24913202-24913299 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR157a
ath-MIR157bchr1: 24921086-24921217 [+]
ath-MIR157achr1: 24913202-24913299 [-]
Database links

Mature sequence ath-miR157a-5p

Accession MIMAT0000172
Previous IDsath-miR157a
Sequence

4 - 

uugacagaagauagagagcac

 - 24

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 3'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR157a-3p

Accession MIMAT0031870
Sequence

75 - 

gcucucuagccuucugucauc

 - 95

Get sequence
Evidence not experimental

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).