Stem-loop sequence ath-MIR156f

AccessionMI0000183 (change log)
DescriptionArabidopsis thaliana miR156f stem-loop
Gene family MIPF0000008; MIR156
Literature search

78 open access papers mention ath-MIR156f
(757 sentences)

Stem-loop
      u  u    aauu  ---u      a  -                    ggcu   uu    auuug 
5' gag gg gagg    ga    ggugac ga agagagugagcacacauggu    uuc  gcau     a
   ||| || ||||    ||    |||||| || ||||||||||||||||||||    |||  ||||     a
3' cuc cc cucc    cu    ccacug cu ucucucacucguguguaucg    aag  cgua     g
      -  u    cucu  uccc      c  a                    ----   uu    ccuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

MIR156f is thought to target 10 mRNAs coding for proteins containing the Squamosa-promoter Binding Protein (SBP) box [1]. The complementary sites are downstream of this conserved domain, within a poorly conserved protein-coding context or the 3' UTR [2].

Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr5: 9136106-9136237 [+]
intergenic
Database links

Mature sequence ath-miR156f-5p

Accession MIMAT0000171
Previous IDsath-miR156f
Sequence

21 - 

ugacagaagagagugagcac

 - 40

Get sequence
Evidence experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

Mature sequence ath-miR156f-3p

Accession MIMAT0031869
Sequence

92 - 

gcucacucucuauccgucacc

 - 112

Get sequence
Evidence not experimental

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).