|
miRBase |
|
Stem-loop sequence ath-MIR156a |
|||||
| Accession | MI0000178 | ||||
| Description | Arabidopsis thaliana miR156a stem-loop | ||||
| Gene family | MIPF0000008; MIR156 | ||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA. |
||||
| Stem-loop |
c aac -aa a - - a --- uu ua aagaga gca gaa cugacagaa gag agugagcac caa aggcaa ugca u |||||| ||| ||| ||||||||| ||| ||||||||| ||| |||||| |||| uucucu cgu cuu gacugucuu cuc ucacucgug guu uucguu acgu c u agu ggc a u g c cuc -c ua |
||||
| Deep sequencing |
| ||||
| Comments |
MIR156a is found on chromosome 2 in Arabidopsis thaliana [1] and is thought to target 10 mRNAs coding for proteins containing the Squamosa-promoter Binding Protein (SBP) box. The complementary sites are downstream of this conserved domain, within a poorly conserved protein-coding context or the 3' UTR [2]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence ath-miR156a |
|
| Accession | MIMAT0000166 |
| Sequence |
21 - ugacagaagagagugagcac - 40 |
| Deep sequencing | 12490 reads, 8 experiments |
| Evidence | experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Solexa [6] |
| Validated targets |
|
References |
|
| 1 |
PMID:12101121
"MicroRNAs in plants"
Genes Dev. 16:1616-1626(2002).
|
| 2 |
PMID:12202040
"Prediction of plant microRNA targets"
Cell. 110:513-520(2002).
|
| 3 |
PMID:16040653
"Expression of Arabidopsis MIRNA genes"
Plant Physiol. 138:2145-2154(2005).
|
| 4 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
| 5 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|
| 6 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|