Stem-loop sequence ath-MIR156a

Accession MI0000178
Description Arabidopsis thaliana miR156a stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c      aac   -aa   a         -   -         a   ---      uu    ua 
 aagaga   gca   gaa cugacagaa gag agugagcac caa   aggcaa  ugca  u
 ||||||   |||   ||| ||||||||| ||| ||||||||| |||   ||||||  ||||   
 uucucu   cgu   cuu gacugucuu cuc ucacucgug guu   uucguu  acgu  c
u      agu   ggc   a         u   g         c   cuc      -c    ua 
Get sequence
Deep sequencing
12748 reads, 8 experiments
Comments

MIR156a is found on chromosome 2 in Arabidopsis thaliana [1] and is thought to target 10 mRNAs coding for proteins containing the Squamosa-promoter Binding Protein (SBP) box. The complementary sites are downstream of this conserved domain, within a poorly conserved protein-coding context or the 3' UTR [2].

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr2: 10676451-10676573 [-]
intergenic
Database links

Mature sequence ath-miR156a

Accession MIMAT0000166
Sequence

21 - 

ugacagaagagagugagcac

 - 40

Get sequence
Deep sequencing 12490 reads, 8 experiments
Evidence experimental; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Solexa [6]
Validated targets

References

1
PMID:12101121 "MicroRNAs in plants" Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP Genes Dev. 16:1616-1626(2002).
2
PMID:12202040 "Prediction of plant microRNA targets" Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP Cell. 110:513-520(2002).
3
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
4
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
5
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
6
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).