miRBase has moved to http://www.mirbase.org/ - please update your links.

Stem-loop sequence MI0000177

Accession MI0000177
ID mmu-mir-155
Symbol MGI:Mir155
Description Mus musculus miR-155 stem-loop
Stem-loop 
              ugu a        uu gcc 
cuguuaaugcuaau   g uagggguu  g   u
||||||||||||||   | ||||||||  |    
gacaauuacgauug   c auccucag  c   c
              --u c        -u agu
Get sequence
Comments

Mouse mir-155 resides in the non-coding BIC transcript (EMBL:AY096003), located on chromosome 16 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (NCBIM37) Overlapping transcripts
16: 84714385-84714449 [+]
intergenic

View flanking features
Database links
Gene family

MIPF0000157; mir-155

Mature sequence MIMAT0000165

Accession MIMAT0000165
ID mmu-miR-155
Sequence

4 -  

uuaaugcuaauugugauaggggu

 - 26

Get sequence
Evidence experimental; cloned [1,3]
Predicted targets

References

1
"Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
"New human and mouse microRNA genes found by homology search" Weber MJ FEBS J. 272:59-73(2005).
3
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).