Stem-loop sequence mmu-mir-155

AccessionMI0000177 (change log)
Symbol MGI:Mir155
DescriptionMus musculus miR-155 stem-loop
Gene family MIPF0000157; mir-155
Literature search

508 open access papers mention mmu-mir-155
(7985 sentences)

Stem-loop
                 ugu a        uu gcc 
5' cuguuaaugcuaau   g uagggguu  g   u
   ||||||||||||||   | ||||||||  |    
3' gacaauuacgauug   c auccucag  c   c
                 --u c        -u agu 
Get sequence
Deep sequencing
142071 reads, 389 reads per million, 105 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Mouse mir-155 resides in the non-coding BIC transcript (EMBL:AY096003), located on chromosome 16 [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 84714140-84714204 [+]
sense
ENSMUST00000180991 ; Gm26667-201; exon 2
Database links

Mature sequence mmu-miR-155-5p

Accession MIMAT0000165
Previous IDsmmu-miR-155
Sequence

4 - 

uuaaugcuaauugugauaggggu

 - 26

Get sequence
Deep sequencing139675 reads, 105 experiments
Evidence experimental; cloned [1,3], Illumina [5]
Database links
Predicted targets

Mature sequence mmu-miR-155-3p

Accession MIMAT0016993
Previous IDsmmu-miR-155*
Sequence

43 - 

cuccuaccuguuagcauuaac

 - 63

Get sequence
Deep sequencing2393 reads, 63 experiments
Evidence experimental; 454 [4], Illumina [5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).