Stem-loop sequence mmu-mir-154

AccessionMI0000176
Symbol MGI:Mir154
DescriptionMus musculus miR-154 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
               u      ugcc    - uuu 
5' gaagauagguua ccgugu    uucg c   a
   |||||||||||| ||||||    |||| |   u
3' uuuuuauccagu ggcaca    aagc g   u
               u      uacu    a ugc 
Get sequence
Deep sequencing
39149 reads, 557 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr12: 109738433-109738498 [+]
sense
OTTMUST00000113369 ; Mirg-006; intron 1
OTTMUST00000113370 ; Mirg-002; intron 1
OTTMUST00000113366 ; Mirg-004; intron 2
OTTMUST00000113367 ; Mirg-001; intron 2
OTTMUST00000113368 ; Mirg-005; intron 2
OTTMUST00000114051 ; Mirg-010; intron 7
OTTMUST00000114052 ; Mirg-009; intron 8
OTTMUST00000114049 ; Mirg-011; intron 11
ENSMUST00000182231 ; Mirg-006; intron 1
ENSMUST00000181496 ; Mirg-002; intron 1
ENSMUST00000083514 ; Mir154-201; exon 1
ENSMUST00000182268 ; Mirg-004; intron 2
ENSMUST00000181543 ; Mirg-001; intron 2
ENSMUST00000183116 ; Mirg-005; intron 2
ENSMUST00000182185 ; Mirg-010; intron 7
ENSMUST00000182499 ; Mirg-009; intron 8
ENSMUST00000183144 ; Mirg-011; intron 11
Clustered miRNAs
< 10kb from mmu-mir-154
mmu-mir-544chr12: 109729325-109729402 [+]
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
mmu-mir-3072chr12: 109747878-109747960 [+]
Database links

Mature sequence mmu-miR-154-5p

Accession MIMAT0000164
Previous IDsmmu-miR-154
Sequence

6 - 

uagguuauccguguugccuucg

 - 27

Get sequence
Deep sequencing14408 reads, 54 experiments
Evidence experimental; cloned [1,3-4], PCR [2], Illumina [5-6]
Predicted targets

Mature sequence mmu-miR-154-3p

Accession MIMAT0004537
Previous IDsmmu-miR-154*
Sequence

42 - 

aaucauacacgguugaccuauu

 - 63

Get sequence
Deep sequencing20130 reads, 55 experiments
Evidence experimental; cloned [4], Illumina [5-6]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
3
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).