Stem-loop sequence mmu-mir-153

AccessionMI0000175 (change log)
Symbol MGI:Mir153
DescriptionMus musculus miR-153 stem-loop
Gene family MIPF0000050; mir-153
Literature search

32 open access papers mention mmu-mir-153
(714 sentences)

Stem-loop
        -             gu       -a  aa 
5' cggug ucauuuuugugac  ugcagcu  gu  u
   ||||| |||||||||||||  |||||||  ||  a
3' guuac agugaaaacacug  acguuga  cg  u
        u             au       cc  ag 
Get sequence
Deep sequencing
77131 reads, 821 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 117250817-117250885 [+]
sense
ENSMUST00000070733 ; Ptprn2-201; intron 19
Database links

Mature sequence mmu-miR-153-5p

Accession MIMAT0016992
Previous IDsmmu-miR-153*
Sequence

5 - 

gucauuuuugugacguugcagcu

 - 27

Get sequence
Deep sequencing777 reads, 28 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

Mature sequence mmu-miR-153-3p

Accession MIMAT0000163
Previous IDsmmu-miR-153
Sequence

44 - 

uugcauagucacaaaagugauc

 - 65

Get sequence
Deep sequencing76353 reads, 47 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).