Stem-loop sequence mmu-mir-152

AccessionMI0000174
Symbol MGI:Mir152
DescriptionMus musculus miR-152 stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
                    g  a    cc    cgg   c 
5' ccgggccuagguucugu au cacu  gacu   gcu u
   ||||||||||||||||| || ||||  ||||   |||  
3' ggcccggguucaagaca ua guga  cuga   cga g
                    g  c    --    ---   g 
Get sequence
Deep sequencing
682944 reads, 3.24e+03 reads per million, 108 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 96850393-96850465 [+]
sense
OTTMUST00000003413 ; Copz2-002; intron 1
OTTMUST00000003223 ; Copz2-001; intron 1
OTTMUST00000003414 ; Copz2-003; intron 1
ENSMUST00000155696 ; Copz2-002; intron 1
ENSMUST00000018816 ; Copz2-001; intron 1
ENSMUST00000145633 ; Copz2-003; intron 1
Database links

Mature sequence mmu-miR-152-5p

Accession MIMAT0016991
Previous IDsmmu-miR-152*
Sequence

8 - 

uagguucugugauacacuccgacu

 - 31

Get sequence
Deep sequencing571 reads, 54 experiments
Evidence experimental; 454 [6], Illumina [7]
Predicted targets

Mature sequence mmu-miR-152-3p

Accession MIMAT0000162
Previous IDsmmu-miR-152
Sequence

47 - 

ucagugcaugacagaacuugg

 - 67

Get sequence
Deep sequencing498182 reads, 87 experiments
Evidence experimental; cloned [1-4], Illumina [5,7]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
3
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).