Stem-loop sequence mmu-mir-151

AccessionMI0000173
Symbol MGI:Mir151
DescriptionMus musculus miR-151 stem-loop
Gene family MIPF0000057; mir-28
Stem-loop
       c            ca          u uc 
5' ccug ccucgaggagcu  cagucuagua g  u
   |||| ||||||||||||  |||||||||| |  c
3' ggac ggaguuccucgg  gucagaucau c  c
       a            -a          c cu 
Get sequence
Deep sequencing
298364 reads, 874 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr15: 73254815-73254882 [-]
sense
ENSMUST00000110036 ; Ptk2-201; intron 22
ENSMUST00000170939 ; Ptk2-202; intron 23
Database links

Mature sequence mmu-miR-151-5p

Accession MIMAT0004536
Sequence

8 - 

ucgaggagcucacagucuagu

 - 28

Get sequence
Deep sequencing26148 reads, 91 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Predicted targets

Mature sequence mmu-miR-151-3p

Accession MIMAT0000161
Previous IDsmmu-miR-151
Sequence

43 - 

cuagacugaggcuccuugagg

 - 63

Get sequence
Deep sequencing39603 reads, 93 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).