Stem-loop sequence mmu-mir-150

Accession

MI0000172

Symbol

MGI:Mir150

Description

Mus musculus miR-150 stem-loop

Gene family

MIPF0000197; mir-150

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-150. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-150 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-150 functions in hematopoiesis; it regulates genes whose downstream products encourage differentiating stem cells towards becoming megakaryocytes rather than erythrocytes. It is also thought to control B and T cell differentiation, alongside mir-155.

Stem-loop

            ac   u       u -   u 
cccugucuccca  ccu guaccag g cug g
||||||||||||  ||| ||||||| | ||| c
gggauagggggu  gga caugguc c gac c
            cc   -       c a   u 

Deep sequencing

209385 reads, 94 experiments

Genome context

• Coordinates (GRCm38): chr7: 45121757-45121821 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-150

• mmu-mir-150: chr7: 45121757-45121821 [+]
• mmu-mir-5121: chr7: 45126918-45126991 [-]

Database links

• EMBL:AJ459762
• ENTREZGENE: 387168;Mir150
• MGI: 2676835;Mir150

Mature sequence mmu-miR-150-5p

• Accession: MIMAT0000160
• Previous IDs: mmu-miR-150
• Sequence: 6 - ucucccaacccuuguaccagug - 27
• Deep sequencing: 88468 reads, 80 experiments
• Evidence: experimental; cloned [1-2], Solexa [3-4]
• Validated targets:
  • TARBASE:mmu-miR-150-5p
• Predicted targets:
  • DIANA-MICROT:mmu-miR-150-5p
  • MICRORNA.ORG:mmu-miR-150-5p
  • MIRDB:mmu-miR-150-5p
  • RNA22-MMU:mmu-miR-150-5p
  • TARGETSCAN-VERT:mmu-miR-150

Mature sequence mmu-miR-150-3p

• Accession: MIMAT0004535
• Previous IDs: mmu-miR-150*
• Sequence: 42 - cugguacaggccugggggauag - 63
• Deep sequencing: 105505 reads, 66 experiments
• Evidence: experimental; cloned [2], Solexa [3-4]
• Predicted targets:
  • DIANA-MICROT:mmu-miR-150-3p
  • MICRORNA.ORG:mmu-miR-150-3p
  • MIRDB:mmu-miR-150-3p
  • RNA22-MMU:mmu-miR-150-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).