Stem-loop sequence mmu-mir-150

Accession MI0000172
Symbol MGI:Mir150
Description Mus musculus miR-150 stem-loop
Gene family MIPF0000197; mir-150
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-150. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-150 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-150 functions in hematopoiesis; it regulates genes whose downstream products encourage differentiating stem cells towards becoming megakaryocytes rather than erythrocytes. It is also thought to control B and T cell differentiation, alongside mir-155.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
            ac   u       u -   u 
cccugucuccca  ccu guaccag g cug g
||||||||||||  ||| ||||||| | ||| c
gggauagggggu  gga caugguc c gac c
            cc   -       c a   u 
Get sequence
Deep sequencing
209385 reads, 94 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr7: 45121757-45121821 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-150
mmu-mir-150 chr7: 45121757-45121821 [+]
mmu-mir-5121 chr7: 45126918-45126991 [-]
Database links

Mature sequence mmu-miR-150-5p

Accession MIMAT0000160
Previous IDs mmu-miR-150
Sequence

6 - 

ucucccaacccuuguaccagug

 - 27

Get sequence
Deep sequencing 88468 reads, 80 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-150-3p

Accession MIMAT0004535
Previous IDs mmu-miR-150*
Sequence

42 - 

cugguacaggccugggggauag

 - 63

Get sequence
Deep sequencing 105505 reads, 66 experiments
Evidence experimental; cloned [2], Solexa [3-4]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).