Stem-loop sequence mmu-mir-146a

AccessionMI0000170 (change log)
Previous IDsmmu-mir-146
Symbol MGI:Mir146
DescriptionMus musculus miR-146a stem-loop
Gene family MIPF0000103; mir-146
Literature search

364 open access papers mention mmu-mir-146a
(4521 sentences)

Stem-loop
       cu            c        auauc 
5' agcu  gagaacugaauu cauggguu     a
   ||||  |||||||||||| ||||||||      
3' ucga  uucuugacuuaa guguccag     a
       -c            a        acugu 
Get sequence
Deep sequencing
709159 reads, 1.23e+03 reads per million, 111 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 43374397-43374461 [-]
intergenic
Database links

Mature sequence mmu-miR-146a-5p

Accession MIMAT0000158
Previous IDsmmu-miR-146;mmu-miR-146a
Sequence

6 - 

ugagaacugaauuccauggguu

 - 27

Get sequence
Deep sequencing709100 reads, 112 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-146a-3p

Accession MIMAT0016989
Previous IDsmmu-miR-146a*
Sequence

42 - 

ccugugaaauucaguucuucag

 - 63

Get sequence
Deep sequencing59 reads, 25 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).