Stem-loop sequence mmu-mir-146a

Accession MI0000170
Previous IDs mmu-mir-146
Symbol MGI:Mirn146
Description Mus musculus miR-146a stem-loop
Gene family MIPF0000103; mir-146
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-146. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-146 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-146 is primarily involved in the regulation of inflammation and other process that function in the innate immune system. Loss of functional miR-146 (and mir-145) could predispose an individual to suffer from chromosome 5q deletion syndrome. miR-146 has also been reported to be highly upregulated in osteoarthritis cartilage, and could be involved in its pathogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
    cu            c        auauc 
agcu  gagaacugaauu cauggguu     a
||||  |||||||||||| ||||||||      
ucga  uucuugacuuaa guguccag     a
    -c            a        acugu 
Get sequence
Deep sequencing
328085 reads, 96 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr11: 43374397-43374461 [-]
intergenic
Database links

Mature sequence mmu-miR-146a-5p

Accession MIMAT0000158
Previous IDs mmu-miR-146;mmu-miR-146a
Sequence

6 - 

ugagaacugaauuccauggguu

 - 27

Get sequence
Deep sequencing 326981 reads, 81 experiments
Evidence experimental; cloned [1-2], Solexa [3-4]
Validated targets
Predicted targets

Mature sequence mmu-miR-146a-3p

Accession MIMAT0016989
Previous IDs mmu-miR-146a*
Sequence

42 - 

ccugugaaauucaguucuucag

 - 63

Get sequence
Deep sequencing 32 reads, 18 experiments
Evidence experimental; Solexa [4]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).